We narrowed to 4,483 results for: Gaa
-
Plasmid#251815PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertISDra2 TnpB with guide targeting NbPDS flanked by HH-HDV ribozymes
TagsAtFDnlsExpressionPlantAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBS NL4-3 envFS eGFP 5'CMV Δtat ΔTARx2_d2TetOp
Plasmid#101349Purpose2xTet Operator inserted between NFkB and Sp1 sites in U3 of HIV-1 delta tat with 5' CMV-R-U5. 5' and 3' TAR elements were mutated to: 5'-GGTCTCTCTGGTTAGACCAGAAAGGAGCATTGGAGCTCTCTGGCTAACTAGGGAACCC-3DepositorInsertNL4-3
UseLentiviralMutationdelta tat delta TAR delta env GFP in Nef Tet ope…Available SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEND-349_Cacnes_ori
Plasmid#225604PurposeCutibacterium acnes replicative plasmid for recombinant expression. pBRESP36A-based vector with C. acnes chloramphenicol resistance, harbouring a medium-copy pBR322 E. coli ori (no ROP)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CLTC G9.4 gRNA
Plasmid#90634Purpose3rd generation lentiviral gRNA plasmid targeting human CLTCDepositorInsertCLTC (Guide Designation G9.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEND-321_Cacnes_ori
Plasmid#225603PurposeCutibacterium acnes replicative plasmid for recombinant expression. pBRESP36A-based vector optimized for reduced size and modular assembly, harbouring a high-copy pBR322 E. coli oriDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-P3-IgKL-SpyCatcher003-SEP
Plasmid#234541Purposeto express a pH sensor tagged with SpyCatcher in the liverDepositorInsertIgKL-SpyCatcher003-SEP
UseAAVMutationNonePromoterP3Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
DKC1 F1.3 gRNA
Plasmid#90652Purpose3rd generation lentiviral gRNA plasmid targeting human DKC1DepositorInsertDKC1 (Guide Designation F1.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-31-murderous_crow
Plasmid#138986PurposeIVT template for the beta subunit of the mouse TCR #31 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-mTagBFP2-2A-Puro_hU6-RfxDR36-BsmBI
Plasmid#226011PurposeCasRx guide RNA cloning backbone (lenti)DepositorTypeEmpty backboneUseLentiviralAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEND-446_Cacnes_ProA
Plasmid#225609PurposeSuicide C. acnes vector to generate ProA (PPA_RS04250) deletion leaving an Ery resistance cassette flanked by BxbI recombination sitesDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAD-eLACCO2.1
Plasmid#208017PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2.1
ExpressionBacterialAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS1222
Plasmid#63791PurposeVector to create a cassette for homologous recombination in S. cerevisiae; adds a C-terminal eGFP Twin-Strep tag followed by URA3 selection markerDepositorInserteGFP-Twin-Strep tag followed by URA3
UseE. coli cloning vectorTagseGFP-Twin-Strep tagPromoternoneAvailable SinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Dot1L_1
Plasmid#36339DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
shTBX5 # 1
Plasmid#42549DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEND-418_Cacnes_LysA
Plasmid#225607PurposeSuicide C. acnes vector to generate LysA (PPA_RS06345) deletion leaving an Ery resistance cassette flanked by BxbI recombination sitesDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS1021
Plasmid#59575PurposeVector to create a cassette for homologous recombination in S. cerevisiae; adds a C-terminal Twin-Strep tag and a TRP1 selection markerDepositorInsertTwin-Strep tag optimized for PCR amplification followed by TRP1 selection marker
UseE. coli cloning vectorTagsTwin-Strep tagPromoterNoneAvailable SinceAug. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEND-193_Cacnes_HS
Plasmid#225622PurposeC. acnes with heat shock inducible expression of pFAST. pBRESP36A with P(PPA_RS10245)+RBS_1+pFAST // P(PPA_RS06745)+RBS_1+HspR(PPA_RS10230)DepositorInsertHspR
UseSynthetic BiologyTagspFAST-6XHisExpressionBacterialAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-192_Cacnes_HS
Plasmid#225621PurposeC. acnes with heat shock inducible expression of pFAST. pBRESP36A with P(PPA_RS10245)+RBS_1+pFAST // P(PPA_RS09160)+RBS_1+HspR(PPA_RS10230).DepositorInsertHspR
UseSynthetic BiologyTagspFAST-6XHisExpressionBacterialAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only