We narrowed to 15,000 results for: GRN
-
Plasmid#209450PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterHvU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70190
Plasmid#209451PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterHvU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6-Nme2_tracr
Plasmid#192146PurposeExpresses Nme2-sgRNA cloned with BspQIDepositorInsertNme2 sgRNA scaffold
UseAAVExpressionMammalianAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT1
Plasmid#183282PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT1 geneDepositorInsertDNMT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT3B
Plasmid#183284PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT3B geneDepositorInsertDNMT3B
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ESR1
Plasmid#183288PurposeAll-in-One CRISPRko system with a guide RNA that targets ESR1 geneDepositorInsertESR1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1B
Plasmid#183338PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1B
UseLentiviralAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AAVS1A
Plasmid#183337PurposeAll-in-One CRISPRko system with a guide RNA that targets the AAVS1 locusDepositorInsertAAVS1A
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MYC
Plasmid#183330PurposeAll-in-One CRISPRko system with a guide RNA that targets MYC geneDepositorInsertMYC
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP2B
Plasmid#183325PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP2B geneDepositorInsertTOP2B
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PDGFRB
Plasmid#183314PurposeAll-in-One CRISPRko system with a guide RNA that targets PDGFRB geneDepositorInsertPDGFRB
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_JAK2
Plasmid#183303PurposeAll-in-One CRISPRko system with a guide RNA that targets JAK2 geneDepositorInsertJAK2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_IDH2
Plasmid#183301PurposeAll-in-One CRISPRko system with a guide RNA that targets IDH2 geneDepositorInsertIDH2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC3
Plasmid#183299PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC3 geneDepositorInsertHDAC3
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT3
Plasmid#183293PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT3 geneDepositorInsertFLT3
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CSF1R
Plasmid#183277PurposeAll-in-One CRISPRko system with a guide RNA that targets CSF1R geneDepositorInsertCSF1R
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRT2B-GO
Plasmid#136908PurposeLentivirus expressing GO sgRNADepositorInsertsgGO
UseLentiviralMutationWTPromoterhU6Available SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSDMA66
Plasmid#128355PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.DepositorInsertNoureothricin (NAT)
UseUnspecifiedPromoterACT1Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGC
Plasmid#112812PurposePCR template vector for amplifying gRNA(F+E)-OstRNA fragmentDepositorInsertgRNAcore(F+E)-tRNA
ExpressionBacterialAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only