We narrowed to 15,275 results for: grn
-
Plasmid#17491PurposeRetroviral Luciferase shRNA (H1/TO promoter), 3’LTR insertion, PuroDepositorPublicationInsertFirefly Luciferase shRNA
UseRNAi and RetroviralAvailable sinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA098
Plasmid#245320PurposeCas9 CRISPRko all-in-one positive control; targets CD47DepositorAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA102
Plasmid#245324PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSLHDR_R4
Plasmid#124211PurposegRNA/Cas9 expression for 2nd editing using pSLHDR04DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA
UseCRISPRAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_SpCas9
Plasmid#107328PurposeU6 driven SpCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_NmCas9
Plasmid#107329PurposeU6 driven NmCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available sinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA104
Plasmid#245326PurposeCas9 CRISPRa positive control guide; targets CD4DepositorAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp KI;Empty
Plasmid#240302PurposeEmpty vectorDepositorInsertEmpty gRNA
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJMP2824
Plasmid#160671PurposeMobile CRISPRi sfGFP 'test', empty sgRNADepositorInsertempty sgRNA (BsaI)
ExpressionBacterialAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP1344
Plasmid#119273Purposeknockdown folA in E. aerogenesDepositorInsertsgRNA folA (E. aerogenes)
ExpressionBacterialMutationD10A and H840AAvailable sinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1239
Plasmid#119263Purposeknockdown folA in P. aeruginosaDepositorInsertsgRNA folA (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas39
Plasmid#82389PurposesgRNA targeting glnA expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas36
Plasmid#82388PurposesgRNA targeting ccmK expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas35
Plasmid#82387PurposesgRNA targeting cpcB expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT42
Plasmid#223414PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT448
Plasmid#139388PurposeBile Acid inducible sgRNA-1 with PM1 driving Nanoluc expression (NOT Gate 1), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-1 with PM1 driving Nanoluc expression (NOT Gate 1),
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable sinceJan. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT492
Plasmid#139397PurposeBile Acid inducible sgRNA-5 with PM5 driving Nanoluc expression (NOT Gate 5), pNBU1 backbone, AmpR, ErmRDepositorInsertBile Acid inducible sgRNA-5 with PM5 driving Nanoluc expression (NOT Gate 5)
UseSynthetic BiologyPromoterBile Acid inducible PromoterAvailable sinceJan. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnxABE-flgn
Plasmid#187932PurposeA-to-G base editorDepositorPublicationInsertecTadA(8e)-nxCas9 (D10A)
UseCRISPRExpressionBacterialAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS2
Plasmid#140625PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS2. The crRNA-IS2 targets IS2 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS2
UseCRISPR; TransposonExpressionBacterialAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only