We narrowed to 19,291 results for: CAL
-
Plasmid#85125PurposeKaiB expressed from native promoter from NSII-Nt. Complements rhythms of kaiB null strain.DepositorInsertPkaiB-kaiB
ExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL1632
Plasmid#62829PurposeLim Lab plasmid: AmpR + PLlacO-1::RBS(st7) gfp::Asp terminator + ColE1DepositorInsertgfp
UseSynthetic BiologyTagsst7 RBSExpressionBacterialPromoterpLlacO-1Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGex2t SadBs
Plasmid#66882PurposeBacterial expression vector encoding N-terminally GST-tagged short isoform of human SadBDepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-mCherry-CAAX
Plasmid#250168PurposeAAV mediated overexpression of membrane targeted mCherryDepositorInsertmCherry-CAAX
ExpressionMammalianPromotergfaABC1DAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFUW LAMP1Sig-mEmerald
Plasmid#239555PurposeExpression and lysosomal localization of mEmeraldDepositorArticleInsertmEmerald
UseLentiviralPromoterUbCAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_NES-Kinprola_PKA-mEGFP_WRPE-SV40
Plasmid#233366PurposehSyn1 driven expression of the PKA activity recorder Kinprola_PKA fused to mEGFP for neuronal expression through AAV transductionDepositorInsertNES-Kinprola_PKA-mEGFP
UseAAVTagsNES and mEGFPPromoterhSyn1Available SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRBV27
Plasmid#237947PurposeEncodes TRBV27 allele and TRAC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRBV2
Plasmid#237903PurposeEncodes TRBV2 allele and TRAC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP14924 - pAAV-AiE0675m-minBG-iCre(297T)-BGHpA
Plasmid#233571PurposeAiE0675m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG_Kinprola_PKA-mEGFP-NLS3__WPRE-SV40
Plasmid#233365PurposeCAG driven expression of the PKA activity recorder Kinprola_PKA fused to mEGFP for mammalian cell expression through AAV transductionDepositorInsertKinprola_PKA-mEGFP-NLS3X
UseAAVTagsmEGFP-NLS3XPromoterCAGAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT61
Plasmid#223433PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG_NES-Kinprola_PKA-mTagBFP2_WPRE-SV40
Plasmid#233364PurposeCAG driven expression of the PKA activity recorder Kinprola_PKA fused to mTagBFP2 for mammalian cell expression through AAV transductionDepositorInsertNES-Kinprola_PKA-mTagBFP2
UseAAVTagsNES and mTagBFP2PromoterCAGAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-303_Cacnes_tetR
Plasmid#225618PurposeC. acnes with tetR-based inducible expression of mCherry. pBRESP36A with P(PPA_RS09745)+RBS_2+TetR // P(BBa_23119-TetO2)+RBS_1+mCherryDepositorInsertTetR
UseSynthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-H1-shSRGAP2B/C#1-hsynapsin-EGFP
Plasmid#220796PurposeshRNA plasmid against human SRGAP2B/C genes (#1) with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_703128
Plasmid#224394PurposeFor expression of the type I CBASS system encoded by Escherichia coli 703128DepositorInsertEcCdnD_4TM
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_BWH59
Plasmid#224393PurposeFor expression of the type I CBASS system encoded by Escherichia coli BWH59DepositorInsert2TM_EcCdnD
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-OST4-mCherry (EcoRV) (XH26)
Plasmid#206475PurposeExpression in Schneider cells for imagingDepositorTypeEmpty backboneExpressionInsectAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only