We narrowed to 27,563 results for: GFP
-
Plasmid#169300PurposeConstitutive overexpression of human ARID3A cDNA with GFP as reporter fluorescent proteinDepositorAvailable sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
ERrefGFP1_pCDNA3
Plasmid#48635PurposeMam vector encoding for the ER targeted and FLAGM1 tagged insensitive variant of fluorescent redox probe roGFPiE with mut Cys147 to Ser, del insertion147b and mut Cys204 to Glut.Referred to as ref GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertERrefGFP1
TagsFLAGExpressionMammalianMutationC147S,C204QAvailable sinceOct. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple (bidirectional) GasS
Plasmid#196055PurposeEncodes a G alpha subunit (GNAS2) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pARNTL.1.0-gDNA
Plasmid#112480PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ARNTLDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertARNTL (BMAL1 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJUNB.1.0-gDNA
Plasmid#112409PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor JUNBDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertJUNB (JUNB Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-zH2B-GFP
Plasmid#226561PurposeExpress H2B-GFP in zebrafish.DepositorAvailable sinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-PI4KB
Plasmid#221759PurposeStable expression of GFP-PI4KB in mammalian cellsDepositorAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-2xFYVE
Plasmid#221750PurposeStable expression of GFP-2xFYVE in mammalian cellsDepositorInserttandem HRS FYVE domain
UseRetroviralTagsGFPExpressionMammalianMutationtwo FYVE domains (amino acids 147-223), linked by…Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC101-GFPmut2(ΔmScarlet)
Plasmid#208185PurposeGFP positive, mScarlet-I negative controlDepositorInsertGFPmut2
UseReporterExpressionBacterialPromoterPtet+dnaK P1Available sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-p62 var2
Plasmid#204575PurposeExpresses GFP-p62 var2 in mammalian cellsDepositorAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
CB6-GFP-TAOK1
Plasmid#197108PurposeExpression of GFP-tagged TAOK1 / PSK2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTAOK1 (TAOK1 Human)
TagsGFPExpressionMammalianMutationWild TypePromoterCMVAvailable sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2B-2A-GFP-IRESpuro2
Plasmid#183746PurposeExpresses H2B-2A-GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2B (H2BC16P Human)
TagsGFP with 2A protease cleavage site between H2B an…ExpressionBacterial and MammalianPromoterCMVAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Avr2-GFP pZK538
Plasmid#118011Purposeexpresses Avr2-GFP (without signal peptide) and mCherry-HDEL. Used for visualization of cell-to-cell movement of Avr2. Avr2 can be replaced with gene of interest via HiFi DNA assembly cloning (NEB) .DepositorPublicationInsertsdspAvr2
mCherry
TagsEGFP and HDELExpressionBacterial and PlantPromoter35SAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ8069 - ACTB GFP-P2A + RAB11A mCherry-P2A CLIP Donor
Plasmid#202689PurposeCLIP donor template to generate 2 knock-ins: GFP into ACTB, and mCherry in RAB11A.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCopGFP
mCherry
Available sinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-Halo,IRES-eGFP
Plasmid#164519PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible GFP and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLX-EF1a_NKX2-1_Short_V5-GFP
Plasmid#221497PurposeNKX2-1-GFP fusion protein lentiviral overexpression using an EF1a promoterDepositorAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pME-QUAS5x:GFPNLS-SV40pA
Plasmid#155115PurposeMiddle entry vector containing QUAS5x element upstream of GFP-NLS.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertQUAS5x:GFPNLS
UseGateway middle entry vectorPromoterQUAS5x-E1bAvailable sinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHCKan-yibDp2-GFPuv
Plasmid#139083PurposeLow phosphate inducible promoter yibDp2 for GFP expressionDepositorInsertyibDp2-GFPuv
ExpressionBacterialAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only