We narrowed to 11,356 results for: AGA
-
Plasmid#227457Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 58kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-36kb-USF
Plasmid#227463Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-26kb-USP
Plasmid#227444Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-24kb-USP
Plasmid#227445Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 24kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL639
Plasmid#231163PurposeT-DNA encoding TRV2 with mobile gRNAs targeting SlHAIRPLUS and SlAN2DepositorInsertmobile gRNAs targeting SlHAIRPLUS and SlAN2
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circNUDC_2
Plasmid#215231PurposeSupression of shcircNUDC(5,RI,6)_2 expressionDepositorInsertcircNUDC shRNA 2 (NUDC Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circNUDC_1
Plasmid#215232PurposeSupression of shcircNUDC(5,RI,6)_1 expressionDepositorInsertcircNUDC shRNA 1 (NUDC Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circMTO1_2
Plasmid#215233PurposeSupression of shcircMTO1(2,RI,3)_2 expressionDepositorInsertcircMTO1 shRNA 2 (MTO1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_RERE_2
Plasmid#215207PurposeSupression of shRERE_2 expressionDepositorInsertRERE shRNA 2 (RERE Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_MTO1_2
Plasmid#215213PurposeSupression of shMTO1_2 expressionDepositorInsertMTO1 shRNA 2 (MTO1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCM100_ PB5'IR-hU6-gRNA-CS1- CAG-tdTomato- PB3'IR
Plasmid#229995PurposePiggyBac sgRNA cloning plasmid with tdTomato reporter with a capture sequence (cs1)DepositorTypeEmpty backboneUseCRISPRTagsNotI site for NEBuilder HiFi DNA Assembly with ss…ExpressionMammalianPromoterCAGAvailable SinceFeb. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PE-pegRNA(BG)-nsgRNA(BG)
Plasmid#232727PurposeA dual-targeting vector that contains PE3 system guide RNAs against BFP (pegRNA(BG) and nsgRNA(BG)) with restriction enzyme sites for insertion of target site guide RNAS (pegRNAs(TS) and nsgRNA(TS)).DepositorInsertpegRNA(BG), nsgRNA(BG), pegRNAs(TS), nsgRNA(TS)
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-1
Plasmid#230081PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-2
Plasmid#230084PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-3
Plasmid#230085PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgGFP
Plasmid#213165PurposeVector with sgGFP for induction of global DNA methylation.DepositorInsertsgGFP
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6 and PGKAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_145
Plasmid#213166PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MAP4
Plasmid#227295PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of MAP4 for knock-in.DepositorAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only