We narrowed to 6,012 results for: ATC
-
Plasmid#234171PurposeHeterologous protein expression of ASCH domain-containing ribonuclease in Escherichia coliDepositorInsert5GUQ
Tags10x HisTag-Smt3ExpressionBacterialPromoterT7Available SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pICSL4723_ CUL3
Plasmid#126891PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ PLDbeta1
Plasmid#126890PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ CUL3
Plasmid#126903PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ PLDbeta1
Plasmid#126902PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-OPN-600
Plasmid#11997DepositorInsertOsteopontin (SPP1 Human)
ExpressionMammalianMutationThe following construct contains the OPN promoter…Available SinceJuly 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSm5-Bsd-P2a-Fkbp-3xF-GGSG
Plasmid#235522PurposeN-terminal tagging vector for Smarca5DepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holA(Y316A)-FLAG-pET(11a)(ACH-)
Plasmid#238346Purposeover-expresses C-terminal FLAG tagged E. coli delta (Y316A) in E. coliDepositorInsertC-terminal FLAG tagged E. coli delta (Y316A) (holA E. coli)
Tags3X FLAGExpressionBacterialMutationY316AAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holB-pET(11a)(ACH-)
Plasmid#237234Purposeover-express E. coli holB (Pol III delta prime subunit)DepositorInsertholB (delta prime) (holB E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIND-HA-ADH
Plasmid#11991DepositorInsertaldehyde dehydrogenase (ALDH1A1 Human)
UseEcdysone inducibleTagsHAExpressionMammalianMutationno mutationsAvailable SinceJuly 25, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAIP4_6IYE
Plasmid#234237PurposeHeterologous protein expression of peptidyl-tRNA hydrolase (PTH) in Escherichia coliDepositorInsert6IYE (pth Acinetobacter baumannii ATCC 19606 = CIP 70.34 = JCM 6841)
Tags10x HisTag-Smt3ExpressionBacterialPromoterT7Available SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHSG+PTDH
Plasmid#66184Purposephosphite dehydrogenaseDepositorInsertPhosphite Dehydrogenase
UseUnspecifiedMutationE175A, A176RAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_NC_chr1
Plasmid#214690PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Sptbn4 Donor;3xV5 KO;Nfasc
Plasmid#240296PurposeKI:Sptbn4 Donor:3xV5 KO:NfascDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKlf4_Halo_Ty2_BactBsd
Plasmid#235512PurposeC-term HALO targeting constructDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBrg1-GGSG_AID_3xF_PP Target2
Plasmid#235523PurposeTargeting construct to make C-term fusion with GGSG-AID-3xFLAG, roxed PgkPuroDepositorAvailable SinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSox2_Halo_Ty2_BactBsd
Plasmid#235513PurposeC-term HALO targeting constructDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only