We narrowed to 12,883 results for: lic
-
Plasmid#223143PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorInsertLmna (LMNA )
UseAAVTagsGFPExpressionMutationPromoterCMVAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1308-AAV-EFSNC-dSaCas9-HP1bNH(111-173)
Plasmid#223153PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1861-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223161PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2046-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223166Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable sinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2 Triple Cryptic Cre recombinase in pTwist-CMV
Plasmid#216162PurposeExpresses Cre recombinase in cells lacking TDP-43 function. Note: It is not recommended to produce lentiviruses containing TDP-REG sequences – see Depositor CommentsDepositorInsertCre recombinase with N-terminal SV40 NLS and C-terminal c-Myc NLS
UseCre/LoxTagsExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-muGFP-hATG2A mLIRΔWIR
Plasmid#215508PurposeExpresses GFP tagged human ATG2A which has the mutation in LC3 interacting region and lacks WIPI interacting region.DepositorInsertAutophagy related 2A (ATG2A Human)
UseRetroviralTagsmuGFPExpressionMammalianMutationP656R (natural variant with no functional relevan…PromoterAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpyTag-RBD Omicron XBB.1.5
Plasmid#214724PurposeExpresses SARS-CoV-2 Omicron XBB.1.5 RBD (receptor-binding domain from Spike) with N-terminal SpyTag fusion in mammalian cellsDepositorInsertReceptor-Binding Domain (S SARS-CoV-2)
UseTagsSpyTagExpressionMammalianMutationPromoterCMVAvailable sinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionTagsExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-4gRNA-GBX2-RFP
Plasmid#192288PurposeExpresses RFP and four sgRNAs against GBX2DepositorInsertRFP and four sgRNA GBX2 (GBX2 Synthetic)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralTagsExpressionMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…PromoterAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-Akna-mOrange2
Plasmid#196893PurposeNeuron-specific expression of Akna fused to mOrange2. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertAkna-mOrange2 (Akna Mouse)
UseCre/Lox; Dre/roxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-Akna-mOrange2
Plasmid#196880PurposeNeuron-specific expression of the centrosomal protein Akna fused to mOrange2DepositorInsertAkna-mOrange2 (Akna Mouse)
UseCre/LoxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-iCre-pA]-lox-2xHA-128-425-Akap9
Plasmid#196897PurposeNeuron-specific expression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to 2xHA-tags.DepositorInsert2xHA-Akap9(128-425) (Akap9 Rat)
UseCre/LoxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-HA-Dre]-lox-mOrange2-NEDD1-gTBD
Plasmid#196894PurposeNeuron-specific expression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange aimed to displace endogenous gamma-TuRC from the centrosome. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertN-gTBD-mOrange2 (NEDD1 Human)
UseCre/Lox; Dre/roxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-PA]-lox-2xHA-CAMSAP3
Plasmid#196895PurposeNeuron-specific expression of Calmodulin Regulated Spectrin Associated Protein Family Member 3 (CAMSAP3) fused to 2xHA-tags. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsert2xHA-CAMSAP3 (Camsap3 Mouse)
UseCre/Lox; Dre/roxTagsExpressionMammalianMutationPromoterQuimeric CAGAvailable sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mOrange2-Cdk5rap2-CTD
Plasmid#196855PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) of Cdk5rap2 fused to mOrange2. Used to displace endogenous Cdk5rap2 from centrosomes.DepositorInsertmOrange2-Cdk5rap2-CTD (Cdk5rap2 Discosoma sp.)
UseTagsExpressionMammalianMutationNone (wt)PromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-Cdk5rap2-CTDdeltaCBD
Plasmid#196856PurposeExpression of the centrosome targeting carboxy-terminal domain (CTD) laking the centrosome binding domain (deltaCBD) of Cdk5rap2 fused to AcGFP. It cannot displace Cdk5rap2 from centrosomesDepositorInsertAcGFP-Cdk5rap2-CTDdeltaCBD (Cdk5rap2 Rat)
UseTagsExpressionMammalianMutationLacking the centrosome-targeting domain (CTD)PromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only