We narrowed to 5,098 results for: Mos

#159222

Can be used to target the mouse Apln locus in mouse eggs or ES cells, in order to drive the mosaic expression of the protein HA-NLS-FlpO

Rui Benedito

Luo et al Nature. 2021 Jan;589(7842):437-441. doi:

Feb. 12, 2021

Academic Institutions and Nonprofits only

#124444

Plasmid for anti-sense in situ probe in vitro transcription

Yingguang Frank Chan

Castro et al Elife. 2019 Jun 6;8:e42014. doi: 10.7554

May 20, 2019

Academic Institutions and Nonprofits only

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#135521

Engineered form of fibroblast growth factor 2 with improved thermostability

Paul Burridge

Kuo et al Stem Cell Reports. 2020 Jan 9. pii: S221

Jan. 6, 2020

Academic Institutions and Nonprofits only

#184316

To study dynamics of G-actin using NMR spectroscopy.

Michael Rosen

Ali et al Nat Struct Mol Biol. 2022 Apr;29(4):320-

May 19, 2022

Academic Institutions and Nonprofits only

#135403

Expresses GFP-tagged bovine Myo10 in mammalian cells.

Richard Cheney

Berg et al Nat Cell Biol. 2002 Mar;4(3):246-50. doi

March 30, 2022

Academic Institutions and Nonprofits only

#195139

~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss induction

Jason Sheltzer

Girish et al Science. 2023 Jul 6:eadg4521. doi: 10.11

March 8, 2023

Academic Institutions and Nonprofits only

#100285

Expression vector for phycocyanobilin (PCB) synthesis and shRNA for human BVRA gene in mammalian cells

Kazuhiro Aoki

Uda et al Proc Natl Acad Sci U S A. 2017 Oct 24. p

Sept. 20, 2017

Academic Institutions and Nonprofits only

#195138

~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss induction

Jason Sheltzer

Girish et al Science. 2023 Jul 6:eadg4521. doi: 10.11

Feb. 7, 2023

Academic Institutions and Nonprofits only

#140196

Chromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.

Yit Heng Chooi

Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.102

Sept. 11, 2020

Academic Institutions and Nonprofits only