We narrowed to 10,985 results for: cat.1
-
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL-15A
Plasmid#113011PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral with phosphomutations (15A)DepositorInsertfull length tral (tral Fly)
ExpressionBacterialMutation15 PNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C 15A
Plasmid#113007PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)DepositorInsertC terminus of tral (tral Fly)
ExpressionBacterialMutationPNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
PFKM gRNA (BRDN0001146108)
Plasmid#77078Purpose3rd generation lentiviral gRNA plasmid targeting human PFKMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SCYL3 gRNA (BRDN0001147728)
Plasmid#76793Purpose3rd generation lentiviral gRNA plasmid targeting human SCYL3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROS1 gRNA (BRDN0001149251)
Plasmid#75991Purpose3rd generation lentiviral gRNA plasmid targeting human ROS1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROS1 gRNA (BRDN0001149105)
Plasmid#75992Purpose3rd generation lentiviral gRNA plasmid targeting human ROS1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-mTRF1deltaBLM
Plasmid#64163PurposeRetroviral vector expressing mouse TRF1 lacking BLM-binding motifs with N-terminal Myc tagDepositorInsertmTRF1 (Terf1 Mouse)
UseRetroviralTagsMycExpressionMammalianMutationDeleted amino acids 313-316 and 339-342 (both BLM…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC1 VAP-B KD/MD
Plasmid#226410PurposeExpression of human VAP-B (mutant K87D/M89D, unable to bind FFAT motifs) fused to mCherry in mammalian cellsDepositorInsertVAP-B (VAPB Human)
TagsHA, T7-Xpress tag, and mCherryExpressionMammalianMutationK87D/M89D mutant, unable to bind FFAT motifsAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTn7xTS
Plasmid#117389PurposeTn7 tagging vector with temperature-sensitive origin of replicationDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-mCherry(-6)-L1
Plasmid#205046PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertmCherry(-6)-L1
TagsMGHHHHHGGExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(-6)-L1
Plasmid#205027PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(-6)-L1
TagsKGRRGKKSRK and MGHHHHHGGAExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(-6)-H1
Plasmid#205030PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(-6)-H1
TagsKKRRRKK and MGHHHHHGGAExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-TRE3Gp-dCas9-Suntag-VP64-EF1Ap-Puro
Plasmid#183409PurposepiggyBAC-based doxycycline-inducible dCas9-5xSuntag-VP64 CRISPR activation plasmid for enhancer and promoter activation in mammalian cellsDepositorInsertdCas9-5xGCN5-P2A-scFV-sfGFP-VP64-GB1
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterTRE3GAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-TRE3Gp-KRAB-dCas9-ecDHFR-IRES-GFP-EF1Ap-Puro
Plasmid#183410PurposepiggyBAC-based doxycycline- and trimethoprim-inducible KRAB-dCas9 CRISPR interference plasmid for enhancer and promoter repression in mammalian cellsDepositorInsertKRAB-dCas9-ecDHFR
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterTRE3GAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKI_ΩBBMVP16&SRDXWUSm1
Plasmid#220349PurposeExpresses BBM-VP16 and SRDX-WUSm1 in plant cellsDepositorTagsSuperman Repression Domain X (SRDX) and VP16 tran…ExpressionPlantMutationtwo amino acid substitution in WUS-box: L255A L25…PromoterCaMV 35S and RPS5AAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_CDC45
Plasmid#244243PurposeExpresses SpCas9 and a sgRNA targeting the human CDC45 loci for knock-in.DepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-ATOH1-T2A-PuroR
Plasmid#162342PurposeLentiviral expression of ATOH1 under the control of the TetON promoterDepositorAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC-hTRF1
Plasmid#64164PurposeRetroviral vector expressing human TRF1 with N-terminal MYC tagDepositorAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
IL2R/hE-cadherin-cytotail
Plasmid#45773DepositorExpressionMammalianMutationInterleukin-2 receptor α subunit extracellular an…PromoterCMVAvailable SinceJune 28, 2013AvailabilityAcademic Institutions and Nonprofits only