We narrowed to 28,934 results for: Tat
-
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_shRNA resistant nmPKA-Cα-mEGFP
Plasmid#114144PurposeThe G2A mutant of the mouse PKA catalytic subunit α C-terminally tagged by monomeric mEGFP. Silent mutations were introduced to make it resistant to shRNA knock-down.DepositorInsertmouse PKA Cα-mEGFP with G2A mutation and silent mutation to resist shRNA knockdown (Prkaca Mouse)
ExpressionMammalianMutationG2A mutation and silent mutation to resist shRNA …Available SinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (IRES-GFP)
Plasmid#85181PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interaction. Co-expresses EGFP for selectionDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD
Plasmid#25049DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
BAP1 C91A
Plasmid#81025PurposeRetroviral vector containing human BAP1 C91A (catalytically inactive mutant) and Thy1.1 selection markerDepositorInsertBAP1 (BAP1 Human)
UseRetroviralExpressionMammalianMutationBAP1 C91A (point mutation, catalytically inactive)Promoter5’LTRAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
CA-RIT-NFAT1 (PGK-Puro)
Plasmid#63214PurposeConstitutively active NFAT1, mutated to interfere selectively with the NFAT:AP-1 interactio. Contains Puromycin selection markerDepositorInsertCA-RIT-NFAT1 (Nfatc2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationAmino acids 1-3 removed; CA: PASSGSSASF mutated t…Available SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449,548,732,899,884 (All)
Plasmid#194190PurposeIncludes the promoter (1kb) of SMTS with 5 mutated KLF binding sites (positions 449,548,732,899,884)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutation5 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 899
Plasmid#194193PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 899)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 899)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 732
Plasmid#194195PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 732)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 732)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 884
Plasmid#194196PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 884)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 884)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449
Plasmid#194197PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 449)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 449)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449,548,732,899 (Quin)
Plasmid#194191PurposeIncludes the promoter (1kb) of SMTS with 4 mutated KLF binding sites (positions 449,548,732,899)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutation4 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449,548,732 (Tri)
Plasmid#194192PurposeIncludes the promoter (1kb) of SMTS with 3 mutated KLF binding sites (positions 449,548,732)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutation3 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 548
Plasmid#194194PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 548)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseMutationmutated KLF binding sites (position 548)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hAR-H874Y
Plasmid#89087Purposemammalian expression of human androgen receptor with prostate cancer somatic mutation H874Y from CWR22 xenograftDepositorInserthAR-H874Y prostate cancer mutant (AR Human)
ExpressionMammalianMutationhAR-H874YPromoterCMVAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-4
Plasmid#118022PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLY164
Plasmid#184140PurposeReporter circuit for hijacking RFP mRNA as CRISPR RNA (target site 3)DepositorInsertsdCas9
tetR
pspFΔHTH::λN22plus
sfgfp
rhaS
UseSynthetic BiologyTagsASV tag and λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPcon, PpspA-R3, PrhaB, and PtetAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY305
Plasmid#184159PurposeReporter circuit for hijacking mRNA of zraP as CRISPR RNADepositorInsertsdCas9
tetR
pspFΔHTH::λN22plus
mutsfgfp
rhaS
UseSynthetic BiologyTagsASV tag and λN22plusExpressionBacterialMutationK140N, Mutations D10A and H840A on WT cas9. Synon…PromoterPcon, PpspA-zraP-22, PrhaB, and PtetAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only