We narrowed to 10,580 results for: ADA
-
Plasmid#236609PurposeKnockouts Ankrd11 in mouse cellsDepositorAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCAG-puro-3xFLAG-ANKRD11-3xHA fragment 6
Plasmid#236623PurposeExpresses human ANKRD11 fragment in mammalian cellsDepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-puro-3xFLAG-ANKRD11-3xHA fragment 2
Plasmid#236619PurposeExpresses human ANKRD11 fragment in mammalian cellsDepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-puro-hANKRD11 (exon 5-2)
Plasmid#236613PurposeKnockouts ANKRD11 in human cellsDepositorAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-puro-3xFLAG-ANKRD11-3xHA fragment 1
Plasmid#236618PurposeExpresses human ANKRD11 fragment in mammalian cellsDepositorAvailable SinceSept. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-puro-hANKRD11 (exon 5-1)
Plasmid#236612PurposeKnockouts ANKRD11 in human cellsDepositorAvailable SinceJune 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-puro-mAnkrd11 (intron 3)
Plasmid#236608PurposeKnockouts Ankrd11 in mouse cellsDepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-LacI-Cyclin B1 ND
Plasmid#234706Purposeallows tethering of non degradable (ND) cyclin B1 protein to lacO repeats in specific chromatin lociDepositorAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGE1.0
Plasmid#165983PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymA origin and Spec resistance.DepositorInsertsRK2/RP4 origin of transfer
repA2B2C2
nourseothricin N-acetyl transferase
spectinomycin/streptomycin resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgBRSK2
Plasmid#138687PurposeExpresses a human BRSK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-GFP-PGK-Puro
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl C
Plasmid#89372PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl B
Plasmid#89371PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl D
Plasmid#89373PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl A
Plasmid#89370PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Progerin-S22D-CS-pLPC
Plasmid#73810PurposeProgerin mutant where Serine 22 is mutated to aspartic acid and where there is a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with substitution of cysteine in CaaX-mo…PromoterCMVAvailable SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPC-S22AProgerin-CS
Plasmid#69063Purposeencodes a Progerin mutant with serine 22 mutated to an alanine and with a substitution of cysteine in CaaX-motif by a serineDepositorInsertProgerin (LMNA Human)
UseRetroviralExpressionMammalianMutationProgerin with serine 22 mutated to alanine and wi…PromoterCMVAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Progerin
Plasmid#118710PurposeLentiviral TET-ON inducible GFP-ProgerinDepositorInsertGFP-Progerin (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only