We narrowed to 6,185 results for: cas9 expression plasmid
-
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310)
Plasmid#242662PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and mouse gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_mouse_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (human) (LLH301)
Plasmid#242661PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and human gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_human_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA
Plasmid#246432PurposeAll-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID, fused to human ADAR2 deaminase domain
mCherry
ωRNA
TagsHIV NES, SGGSSGGSSGSETPGTSESATPESSGGSSGGS linker …ExpressionMammalianMutationR-IscB: changed Aspartic Acid 60 to Alanine, chan…PromoterCMV and U6Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
BPK1520_blastR
Plasmid#175289PurposeHuman expression plasmid for SpCas9 sgRNA with blasticidin co-selectionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMV/U6Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only