We narrowed to 11,393 results for: ENA
-
Plasmid#110854PurposeLentiviral vector for constitutive expression of sgRNAs; includes tdTomato and BlasticidinS resistance markersDepositorInsertsgRNA scaffold with spacer
UseLentiviralMutationWTPromoterU6Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSN067
Plasmid#101748PurposeSingle copy yeast plasmid expressing Cpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1), codon optimized for expression in Saccharomyces cerevisiae.DepositorInsertsCpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1) codon optimized for expression in S. cerevisiae.
KanMX marker expression cassette.
UseCRISPRTagsSV40 NLSExpressionYeastPromoterHeterologous TEF1 promoter from A. gossypii. and …Available SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE3G-BE3RA-PGK-Puro
Plasmid#110846PurposeLentiviral vector for dox-inducible expression of BE3RA in mammalian cells (codon optimized)DepositorInsertBE3RA
UseLentiviralMutationD10APromoterTRE3GAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-dCas9-VP64-6xHis
Plasmid#62935PurposeExpression of dCas9-VP64-6xHis in bacterial cellsDepositorInsertdCas9-VP64
Tags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A and H840A amino acid changes render Cas9 nuc…PromoterT7Available SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBF_HsPepT2
Plasmid#73944PurposeXenopus oocyte expression vector containing the cDNA of human PepT2 with a c terminal flag tagDepositorInsertPepT2 (SLC15A2 Human)
UseMake rna for xenopus oocyte injectionTagsFlagPromoterbeta globinAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBF_HsPepT1
Plasmid#73943PurposeXenopus oocyte expression vector containing the cDNA of human PepT1 with a c terminal flag tagDepositorInsertPepT1 (SLC15A1 Human)
UseMake rna for xenopus oocyte injectionTagsFlagPromoterbeta globinAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-miniTurbo-YFP-NLS
Plasmid#127370PurposeBinary vector for expressing nuclear miniTurbo-YFP under the UBQ10 promoter in plantsDepositorInsertminiTurbo (BirA mutant)
TagsGS linker, NLS, V5, and YFPExpressionPlantMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
KillerRed-LacI-NLS
Plasmid#215102PurposeExpresses KillerRed-LacI-NLS in mammalian cells.DepositorInsertKillerRed-LacI-NLS
ExpressionMammalianPromoterCMVAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSA127 A2UCOE-Cas9-BFP
Plasmid#249151PurposeOverexpression of SpCas9-BFP and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-Cas9-TagBFP
UseCRISPR; Cp36 donor dnaExpressionMammalianPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only