We narrowed to 7,337 results for: GFP expression plasmids
-
Plasmid#193023PurposeAAV vector plasmid expressing enhanced green fluorescent protein (eGFP) under the mouse phosphoglycerate kinase (PGK) promoterDepositorInserteGFP
UseAAVExpressionMammalianPromoterPGKAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/Flag-tGFP-Cryz
Plasmid#110378PurposeMammalian expression of turboGFP-CRYZ with FLAG tag, Flp-In T-Rex systemDepositorAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKC152_Lenti_tetoff_PABP-INT_EF1a_EGFP
Plasmid#250950PurposeA lentiviral vector express PABP-INT fusion protein under a Tetoff system. Contains EGFP as selection marker.DepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
Venus-Bik-GG153AA-pEGFP-C1
Plasmid#177427PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with G153A,G154A mutations in membrane binding region. Mutations made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationGlycines 153 and 154 mutated to alaninePromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL8B-GFP
Plasmid#67404PurposeMammalian expression of hArl8b with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL8A-GFP
Plasmid#67403PurposeMammalian expression of hArl8 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL3-GFP
Plasmid#67397PurposeMammalian expression of hArl3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF6-GFP
Plasmid#67394PurposeMammalian expression of hArf6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL2-GFP
Plasmid#67396PurposeMammalian expression of hArl2 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4C-GFP
Plasmid#67402PurposeMammalian expression of hArl4c with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-SARA-GFP
Plasmid#67410PurposeMammalian expression of hSara with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL6-GFP
Plasmid#67401PurposeMammalian expression of hArl6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARFRP1-GFP
Plasmid#67408PurposeMammalian expression of hArfrp with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF1-GFP
Plasmid#67390PurposeMammalian expression of hArf1 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4-GFP
Plasmid#67398PurposeMammalian expression of hArl4 with C-term GFP tagDepositorInsertARL4 (ARL4A Human)
TagsGFPExpressionMammalianMutationbp 105 A to T; silent mutationPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL5B-GFP
Plasmid#67400PurposeMammalian expression of hArl5b with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF3-GFP
Plasmid#67391PurposeMammalian expression of hArf3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF5-GFP
Plasmid#67393PurposeMammalian expression of hArf5 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only