We narrowed to 17,342 results for: form
-
Plasmid#100098Purposedual expression of human CAD and ICAD. The two caspase cleavage sites in ICAD were mutated to TEVP cleavable sequencesDepositorExpressionBacterialMutationtwo caspase cleavage sites (DETD-117 and DAVD-224…PromoterT7Available SinceJan. 11, 2018AvailabilityAcademic Institutions and Nonprofits only
-
Bxb1-GT_AIO-TetOn_mNgn2 _Down-Tandem
Plasmid#229795PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of mouse neurogenin 2DepositorInsertTRE-mNgn2; rtTA-T2A-mTagBFP2 (Neurog2 Mouse)
UseSynthetic BiologyTagsNLSExpressionMammalianPromoterTRE and CAGAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1WT
Plasmid#230915PurposeExpression of human COL1A1 promoter and testing the promoter activity with luciferase assay.DepositorInsertHuman COL1A1 promoter (COL1A1 Human)
UseLuciferaseTagsluciferase - Luc2pExpressionBacterial and MammalianPromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-NRBP1-FL-N-FLAG
Plasmid#222675Purposeoverexpressing full length NRBP1 with N-terminal FLAGDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-TSC22D2-Nterm-C-FLAG
Plasmid#222683Purposeoverexpressing N-terminus truncation of TSC22D2 with C-terminal FLAGDepositorInsertTSC22D2 (TSC22D2 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationTSC22D2 N-terminus truncationAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGMC00030 (aka pRC0707)
Plasmid#209673PurposeLentiviral vector expressing PP7-P65-HSF1DepositorAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Arl13b scFv [N295B/66]
Plasmid#182086PurposeMammalian Expression of Arl13b scFv. Derived from hybridoma N295B/66.DepositorInsertrecombinant mouse scFv targeting Arl13b (Mus musculus) (Arl13b Mouse)
TagsHA, HisExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 R62D actin-3XNLS P2A mCherry
Plasmid#58477PurposeExpresses nuclear-targeted non-polymerizing R62D mutant of human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianMutationChanged Arginine 62 to Aspartic AcidPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 actin-3XNLS P2A mCherry
Plasmid#58475PurposeExpresses nuclear-targeted human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
JDW 763 (pCS2-EYFP-hsKRAS4B-WT)
Plasmid#156408PurposepCS2 CMV expression vector driving EYFP fused human KRAS4BDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.TRE.HA.RUNX1C.IRES.dTomato.PGK.sfGFP.P2A.Tet3G
Plasmid#181978PurposeHuman RUNX1C gene overexpressionDepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AR-V7-pcw107
Plasmid#64635Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertAR (transcript variant 1, splice isoform) (AR Human)
UseLentiviralMutationsplice isoform*PromoterPGKAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai2-RLuc8
Plasmid#140974PurposeEncodes a G alpha subunit (GNAI2) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai2-Rluc8 (GNAI2 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE
Plasmid#104488PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV8, and AAV9InsertjGCaMP7f
UseAAVTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cavbeta1 Ca2+ channel scFv [N7/18]
Plasmid#206789PurposeMammalian Expression of Cavbeta1 Ca2+ channel scFV. Derived from hybridoma N7/18 scFv.DepositorInsertCavbeta1 Ca2+ channel (Homo sapiens) recombinant scFV (CACNB1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-HAPLN1
Plasmid#200777PurposeExpresses full-length mouse HAPLN1 fused with cysteine-free GFP (cfGFP) under synapsin promoterDepositorHas ServiceAAV8InsertHyaluronan And Proteoglycan Link Protein 1 (Hapln1 Mouse)
UseAAVTagscfGFPPromoterSynapsinAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSF-MCM3/5
Plasmid#116950PurposeExpresses human MCM3 and human MCM5DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
IP3 receptor, type 1 scFv [L24/21]
Plasmid#206790PurposeMammalian Expression of IP3 receptor, type 1 scFV. Derived from hybridoma L24/21 scFv.DepositorInsertIP3 receptor, type 1 (Rattus norvegicus) recombinant scFV (Itpr1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only