We narrowed to 1,428 results for: aav vector plasmid
-
Plasmid#179466PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIDepositorInsertJEDI-2P
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-122 target sites
Plasmid#120298PurposeAAV vector for expression of AcrIIA4 with two miR-122 binding sitesDepositorInsertAcrIIA4-2xmiR-122 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC1-2xmiR-122 target sites
Plasmid#120302PurposeAAV vector for expression of AcrIIC1 with two miR-122 binding sitesDepositorInsertAcrIIC1-2xmiR-122 binding sites
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIC3-2xmiR-122 target sites
Plasmid#120303PurposeAAV vector for expression of AcrIIC3 with two miR-122 binding sitesDepositorInsertAcrIIC3-2xmiR-122 binding sites
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV9:cTNT::3Flag-hYAP S127A
Plasmid#86558PurposeTo produce cardiac specific adeno-associated virus expressing activated human YAP.DepositorInsertYAP (YAP1 Human)
UseAAVTags3FlagMutationSerine 127 was mutated into Alanine, to activate …PromotercTNTAvailable SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_U6-ωRNA*_ISDra2-TnpB-mNG
Plasmid#212968PurposeAAV vector for encoding an ISDra2-TnpB driven by EFs promoterDepositorInsertsISDra2-TnpB-T2A-mNG,
ωRNA*
UseAAV and CRISPRTagsNLS and NLS-FLAGExpressionMammalianPromoterEF1a, T7 and U6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterEf1aAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1124 - pAAV MeCP2 SpCas9(D10A)
Plasmid#112719PurposeAn AAV vector that expresses SpCas9 nickase under a neuronal cell promoterDepositorInsertSpCas9
UseAAVMutationD10APromoterMecp2Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMV2 AAV-RapaInducible-NFZ-HGF
Plasmid#188749PurposeRapamycin inducible AAV vector expressing HGFDepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1079 - pAAV TH gRNA A EF1a EGFP
Plasmid#113159PurposeAn AAV vector that expresses guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV and CRISPRExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1012 - pAAV EF1a DIO Nuc-eYFP
Plasmid#75082PurposeAn AAV packaging vector that expresses Cre-dependent nuclear-localized eYFP under control of the EF1a promoter.DepositorInsertNuc-eYFP
UseAAV and Cre/LoxTagsNLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC710 - pAAV EF1a DIO Mem-AcGFP
Plasmid#75081PurposeAn AAV packaging vector that expresses Cre-dependent membrane-localized AcGFP under control of the EF1a promoter.DepositorInsertMem-AcGFP
UseAAV and Cre/LoxTagsPalmitylation siteExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131004Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of human Synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsKv2.1-HAPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-F391W-G395D-WPRE-SV40
Plasmid#101063PurposeAAV vector expressing CaMPARI2_F391W-G395D (Kd = 530nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorInsertCaMPARI2_F391W-G395D
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC292 - pAAV EF1a floxed hChR2(H134R)-EYFP
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only