We narrowed to 10,815 results for: ESP
-
Plasmid#168124PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gs. Composed of the subunits G alpha s(short isoform) (GNAS) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 1 (GNG1).DepositorUseLuciferaseTagscpVenus on GNG1ExpressionMammalianMutationNLuc is inserted at N136/V137 within GNASAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pET21b(+)_SARS-CoV-2_3CLpro-Q306A
Plasmid#177334Purposebacterial expression of active SARS-CoV-2 3C-like proteinaseDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-PDE4D2cat-ICUE4
Plasmid#181847PurposeICUE4 cAMP sensor tethered to the catalytic domain of PDE4D2.DepositorTagsECFP, PDE4D2(86-418), and cpVenus(L194)ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro_Q306A-HIS
Plasmid#224697PurposeBacterial Expression and Purification of SARS-CoV-2 3CLpro active protease with His-tagDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsGly-Gly-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCS2-Myc(Δ1-143; ΔDeg1ΔDeg2)-GFP-IRES-mCherry (ΔTADΔDeg1ΔDeg2)
Plasmid#231234PurposeMYC stability reporter construct with deletion of the N-terminal region (residues 1-143) and point mutations corresponding to the deletion of degron 1 and 2 for transient expression in mammalian cellsDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro-C145A-Q306A
Plasmid#177335Purposebacterial expression of inactive SARS-CoV-2 3C-like-C145A proteinaseDepositorInsertSARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET21b(+)_SARS-CoV-2_3CLpro_C145A-HIS
Plasmid#224698PurposeBacterial Expression and Purification of SARS-CoV-2 3CLpro inactive protease with His-tagDepositorInsertSARS-CoV-2 3C-like (C145A) proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsGly-Gly-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBIG1a-PAF1CdeltaWDR61
Plasmid#231745PurposeProtein expression in insect cellsDepositorTags3C-Strep(II) and Flag-3CExpressionInsectAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a-PAF1CdeltaCDC73
Plasmid#231746PurposeProtein expression in insect cellsDepositorTags3C-Strep(II)ExpressionInsectAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a-PAF1CdeltaLEO1
Plasmid#231747PurposeProtein expression in insect cellsDepositorTags3C-Strep(II) and Flag-3CExpressionInsectAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EC71174
Plasmid#154067PurposeLevel 2 Golden Gate vector, pL2M-HvHSP17-CREU5-UBQ-loxmCHERRYER-eGFPERDepositorInsertsHS Cre recombinase
Ubiquitin promoter driving mCherry with the 35S terminator, flanked by lox sites, followed by eGFP with the Actin terminator
HYGROMYCIN Resistance Cassette
UseCre/Lox and Synthetic Biology; Golden gateExpressionBacterial and PlantMutationThe Arabidopsis thaliana U5 small nuclear ribonuc…Promoter35S promoter, Hordeum vulgare HSP 17 promoter use…Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a-PAF1C(CTR9/CDC73/PAF1/LEO1/WDR61)
Plasmid#231733PurposeProtein expression in insect cellsDepositorInsertsTags3C-Strep(II) and Flag-3CExpressionInsectAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a-PAF1C-CDC73deltaKIM
Plasmid#231748PurposeProtein expression in insect cellsDepositorInsertsTags3C-Strep(II) and Flag-3CExpressionInsectMutationCDC73(delta290-324)Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a-PAF1C-CDC73-YY/AA
Plasmid#231749PurposeProtein expression in insect cellsDepositorInsertsTags3C-Strep(II) and Flag-3CExpressionInsectMutationCDC73(Y290A, Y293A)Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only