We narrowed to 41,229 results for: KAN;
-
Plasmid#85556Purpose2nd generation lentiviral vector expressing a KRAB-dCas9 fusion protein and GFPDepositorInsertKRAB-dCas9-IRES-GFP
UseCRISPR and LentiviralTags2x NLS, HA Tag, and KRAB domainExpressionMammalianPromoterTRE3GAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSD080A
Plasmid#218138PurposeLentiviral vector expressing evolved degron SD40 fused to eGFP with mCherry control.DepositorInsertSD40-eGFP-IRES2-mCherry
UseLentiviralAvailable SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV CEPIA3mt
Plasmid#58219PurposeGreen fluorescent indicator for calcium imaging in the mitochondria (moderately low affinity variant)DepositorInsertCEPIA3mt
TagsmycExpressionMammalianMutationGCaMP2 N263Y E282V E334D M339LPromoterCMVAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
human STIM1 CFP
Plasmid#19755DepositorAvailable SinceOct. 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMIIS793
Plasmid#238206PurposeExpresses TaTasR with an N-terminal Twin-Strep-SUMO tag. KanRDepositorInsertTaTasR
TagsTwinStrepII-bdSUMOExpressionBacterialAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs-p53DD
Plasmid#22729DepositorAvailable SinceDec. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
NLuc-His10
Plasmid#234567PurposeBacterially expressed NLuc for Ni-NTA purificationDepositorInsertNano luciferase
TagsT7 gene 10 leader peptide and Thrombin site-10xHi…ExpressionBacterialMutationCodon optimized for bacterial expressionPromoterT7Available SinceMay 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGMCtKq28-TSC10M1-sspB
Plasmid#49526PurposeKanamycin resistant; contains qtag28, expresses sspB under a promoter containing PtetO, and constutively expresses single-chain TetR10 (tsc10); integrates into the mycobacteriophage att-Tweety siteDepositorInsertTSC10M1-sspB
ExpressionBacterialAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only