We narrowed to 13,191 results for: BASE

#156477

Bacterial expression of Sars-CoV2 Nsp8 protein with His-tag and GST-tag

Ylva Ivarsson

Mihalic et al Nat Commun. 2023 Sep 13;14(1):5636. doi:

Aug. 4, 2020

Academic Institutions and Nonprofits only

#132587

gRNA used for knockin NanoLuc and tdTomado (separated by 2A) into MYH11 allele (MYH11-NanoLuc-2A-tdTomato vector) )

James Thomson

Zhang et al Stem Cell Reports. 2019 Jun 11;12(6):126

Oct. 8, 2019

Academic Institutions and Nonprofits only

#114089

CAG promoter expression plasmid for human codon optimized FnCas12a nuclease with C-terminal NLS and HA tag

Keith Joung, Benjamin Kleinstiver

Kleinstiver et al Nat Biotechnol. 2019 Feb 11. pii: 10.103

Dec. 11, 2018

Academic Institutions and Nonprofits only

#100168

Used to improve production from engineered biosynthetic pathways include optimizing codon usage, enhancing production of rate-limiting enzymes, and eliminating the accumulation of toxic intermediates or byproducts to improve cell growth

Jay Keasling

Anthony et al Metab Eng. 2009 Jan;11(1):13-9. doi: 10.

Sept. 15, 2017

Academic Institutions and Nonprofits only

#100167

Used to improve production from engineered biosynthetic pathways include optimizing codon usage, enhancing production of rate-limiting enzymes, and eliminating the accumulation of toxic intermediates or byproducts to improve cell growth

Jay Keasling

Anthony et al Metab Eng. 2009 Jan;11(1):13-9. doi: 10.

Sept. 15, 2017

Academic Institutions and Nonprofits only

#97321

HMEJ donor for fusing a p2A-mCherry reporter to mouse Nanog. AAV backbone.

Hui Yang

Yao et al Cell Res. 2017 May 19. doi: 10.1038/cr.2

Aug. 2, 2017

Academic Institutions and Nonprofits only

#97322

HMEJ donor for fusing a p2A-mCherry reporter to mouse Sox2. AAV backbone.

Hui Yang

Yao et al Cell Res. 2017 May 19. doi: 10.1038/cr.2

July 14, 2017

Academic Institutions and Nonprofits only

#87402

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87383

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87386

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only