We narrowed to 15,009 results for: GRN
-
Plasmid#160763PurposeSuppress POLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-SIK2
Plasmid#138696PurposeExpresses a human SIK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDYSCKO
Plasmid#120263PurposeEmpty backbone for cloning any gRNA to be used with the canavanine co-selection systemDepositorInsertDYSCKO cassette
UseCRISPR and Synthetic BiologyPromoterSNR52Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF436.1.0-gDNA
Plasmid#113767PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF436DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF331.1.0-gDNA
Plasmid#112461PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF331DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXD1.1.0-gDNA
Plasmid#112446PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MXD1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFOXA3.1.0-gDNA
Plasmid#112417PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXA3DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFOXO4.1.0-gDNA
Plasmid#112408PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXO4DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G0-R20
Plasmid#101818PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G20-R0
Plasmid#101807PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSico shMAPKAPK3 human
Plasmid#85661Purposeexpression of shRNA targeting human MAPKAPK3DepositorAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.2
Plasmid#85531PurposeInducible expression of guide RNA (huMcl-1.2) with fluorescent GFP reporterDepositorInserthu Mcl-1.2
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PM-BAF180-SH2
Plasmid#41932DepositorInsertBAF180
UseRetroviralExpressionMammalianAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-NEUGRIN
Plasmid#34804DepositorAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2360 - pAAV rActin EGFP donor
Plasmid#228444PurposeAn adeno-associated viral vector to express a SpCas9 guide RNA targeting rat beta actin also carrying an HDR template for insertion of mEGFP to the break site.DepositorInsertmEGFP
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circHUWE1_2
Plasmid#215235PurposeSupression of shcircHUWE1(19,20)_2 expressionDepositorInsertcircHUWE1 shRNA 2 (HUWE1 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only