We narrowed to 19,321 results for: comp
-
Plasmid#233030PurposeTo Express HA tagged DjCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInsertDjCas13d-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-WWE-Linker-eGFP
Plasmid#176072PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertWWE
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-FHA-Linker-eGFP
Plasmid#176065PurposeEGFP fused to the C-terminus of a FHA domain & a hygromycin resistance cassetteDepositorInsertFHA
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Designed VEGF-binding scFv G6des13
Plasmid#110213PurposeYeast Surface Display of G6des13DepositorInsertG6des13
Tagscmyc tagExpressionYeastMutationL A43P, L Q89L, L T94D, L P95T, H Y59H, H Y95FAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_CTD_del321-343
Plasmid#98676PurposeExpresses 6xHis-tagged C-terminal domain of TDP-43 with a deletion of AA 321-343DepositorAvailable SinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mini-Ii-Str_SBP-EGFP-LIMP2
Plasmid#222324PurposeSynchronize the trafficking of LIMP2 from the ER.DepositorInsertStreptavidin-KDEL and LIMP2 fused to SBP-EGFP (SCARB2 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 MP1 shRNA
Plasmid#26632DepositorAvailable SinceNov. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
hRAD18 dSAP-EGFP
Plasmid#68825PurposeExpresses human RAD18 (deleting SAP domain) tagged with EGFPDepositorInserthuman RAD18 (deleting SAP domain) tagged with EGFP (RAD18 Human)
ExpressionMammalianAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GST FNIP2
Plasmid#164982PurposeFNIP2 expressing vector for mammalian cellsDepositorAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRA
Plasmid#108941PurposeMammalian expression of mRIN2 dRADepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
TagsHAExpressionMammalianMutationDeletion of RA domain (aa 751-836)PromoterCMVAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRHVPS9
Plasmid#108942PurposeMammalian expression of mRIN2 dRHVPS9DepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
TagsHAExpressionMammalianMutationDeletion of RHVPS9 domain (aa 455-738)PromoterCMVAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO GFP DNAJB2b
Plasmid#19496DepositorAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-cmyc-optiT1R3 a21-852
Plasmid#113948Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-852PromoterCMVAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-PTBP1-RRM34
Plasmid#89156PurposeRecombinant expression of PTBP1-RRM34 in E.coliDepositorInsertPolypyrimidine Tract Binding Protein 1 RNA Recognition Motif 3+4 (PTBP1 Human)
Tagshexa HisExpressionBacterialMutationcontains RNA Recognition Motif 3+4PromoterT7Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-PBZC-Linker-eGFP
Plasmid#176070PurposeEGFP fused to the C-terminus of a PBZ domain & a hygromycin resistance cassetteDepositorInsertPBZ-C
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-PBM-Linker-eGFP
Plasmid#176069PurposeEGFP fused to the C-terminus of a PBM domain & a hygromycin resistance cassetteDepositorInsertPBM
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
His Puc (aa 1-393)
Plasmid#52295PurposeBacterial expression of His tagged Drosophila Puc fragmentDepositorAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR4-EGFP_opt
Plasmid#106334PurposeGateway Entry vector for EGFP (codon optimized for efficient gene synthesis)DepositorInsertEGFP
UseGateway entry vectorExpressionBacterial and MammalianMutationcodon optimized for gene synthesis without affect…Available SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only