We narrowed to 13,184 results for: BASE
-
Plasmid#103148PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7b-5p target (MIRLET7B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV/TO-miR-30 L5-L2
Plasmid#62123PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a tet-inducible CMV promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseGateway Cloning and RNAiExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3 Pro Mut E2
Plasmid#48750PurposeExpression of luciferase driven by mPer2 promoter fragment containing mutated E-box2 (bases -112 to +98 with respect to transcription start site at +1) and SV40 promoter (backbone)DepositorInsertmPer2 promoter/enhancer region containing mutated E-box2 (-112 to +98)
UseLuciferaseMutationMutated E-box2 sequence from CACGTT to GCTAGTAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHN764
Plasmid#178819PurposeExpression of EndoH in E. coliDepositorInsertsynthetic gene encoding endo-β-N-acetylglucosaminidase H
TagsHIs8 and MBPExpressionBacterialPromotertacAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTF272 (pFA6a-TEV-6xGly-3xFlag-HphMX)
Plasmid#44083DepositorTypeEmpty backboneUsePcr-based yeast c-terminal taggingTags3xFlag, 6xGly linker, ADH1 transcription terminat…Available SinceApril 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RapR-FAK-YM-KD
Plasmid#25929DepositorInsertRapR-FAK (Ptk2 Human, Mouse)
TagsEGFPExpressionMammalianMutationThis pEGFP-RapR-FAK-YM-KD plasmid contains the FA…Available SinceOct. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pminiTol2-5xUAS-sfGFP-zP2A-zB19G-zT2A-zTVA (UGBT)
Plasmid#240274PurposeHelper plasmid for zebrafish rabies virus based-circuit tracingDepositorInsertsB19G (codon-optimized for Danio rerio)
sfGFP (codon-optimized for Danio rerio)
TVA (codon-optimized for Danio rerio)
UseZebrafish expressionAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
VN1897 pB2Hws_v28_Ddcm_wkKanR_TIR51_pLWeakRBS_TIR371_cI-Asf1B+rpoA-2GG
Plasmid#235119PurposeQuantitative bacterial two-hybrid (qB2H). Expresses Asf1B. In fusion cloning to rpoA using BsaI based golden gate.DepositorTypeEmpty backboneUseSynthetic Biology; Quantitative bacterial two-hyb…TagscI_E34PExpressionBacterialAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS4-GCaMP6f
Plasmid#209931PurposeCre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter. Based on construct from Pouchelon et al Cell Rep Methods. 2022.DepositorInsertGCaMP6f
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromoterhSynAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-COX8 MTS-3xFlag-TALE array-CBE6d-UGI-P2A-mCherry-UTR
Plasmid#235202PurposePlasmids for constructing mitoBEs v2DepositorInsertCOX8 MTS-3xFlag-TALE array-CBE6d-UGI-P2A-mCherry-UTR
ExpressionMammalianAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP576
Plasmid#85943PurposeTemperature sensitive plasmid based on pDK46. Expresses dCas9 from proD. Serves as a control for pOP587 - pOP594DepositorInsertdCas9
ExpressionBacterialAvailable SinceJuly 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
AdeC-pET21b
Plasmid#218482PurposeExpresses adenine deaminase in E. coli with a C-terminal his tagDepositorInsertAdenine deaminase
TagsHis tagExpressionBacterialAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vector 1174K
Plasmid#221017PurposeFluorescent based sex separator in Anopheles species mosquitoes (SEPARATOR)DepositorInsertEngineered dobulesex splicing module (Anopheles gambiae)
UseSynthetic BiologyExpressionInsectAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only