We narrowed to 17,757 results for: puro
-
Plasmid#232938PurposeLow expression plasmid of STIM1 with N-terminal mGreenLantern tag for Matreyek Bxb1 (GT) landing padDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLV-Puro-EF1A-hOGG1/Myc
Plasmid#187034PurposeA myc tag fused to the C-terminus of OGG1 and a puromycin resistance cassetteDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTWIST CMV Puro EPB41L4A ORF
Plasmid#242647PurposeExpresses EPB41L4A in mammalian cellsDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR3-SV40-puro
Plasmid#240537PurposeLentiviral eBAR3 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR3
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA eBAR2-SV40-puro
Plasmid#240536PurposeLentiviral eBAR2 backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA-eBAR2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-R66A
Plasmid#241369PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-Y64F
Plasmid#241370PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-E14-ABE-Cas9n-puro
Plasmid#226588PurposeExpress E14-ABE in mammalian cellsDepositorInsertE14-ABE
UseCRISPRExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
TagsiRFP713ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-puro-3Ty:OsAID:3Ty (p5229)
Plasmid#239361PurposepPOTv6 based plasmid template for addition of Ty-epitope tagged Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin inducible degradation domain
UseBacterialTags3 x Ty epitope tagPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SV40-puro-EF1a-HA-NLGN1dAChE-bc
Plasmid#220437PurposeExpresses HA-tagged human NLGN1 with K578A/V579A substitutionsDepositorInsertNeuroligin-1 (NLGN1 Human)
UseLentiviralTagsHA-tagExpressionMammalianMutationK578A and V579A substitutionsPromoterEF1aAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP(N55D)-CNOT7-V5H6.MCh.Puro
Plasmid#209949PurposeIn mammalian cells expresses non-binding TP mutant fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) with a N55D mutation that i…ExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7-V5H6.MCh.Puro
Plasmid#209936PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-(inactive)CNOT6-V5H6.MCh.Puro
Plasmid#209943PurposeIn mammalian cells expresses TP fused to an inactive CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (enzymatically inactive) (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW H2B-mCherry-P2A-PuroR
Plasmid#239554PurposeExpression and nuclear localization of mCherryDepositorArticleInsertmCherry
UseLentiviralPromoterUbCAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
Plasmid#239448PurposeOrthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.DepositorInsertsS.p. gRNA backbone
S.a. gRNA backbone
PuroR-T2A-BFP(C>T_screening)
UseLentiviralExpressionMammalianMutationBFP: T65S, S72S, V145F, K206K, H231LPromoterEF1alpha, U6, and mU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA595 - pBA904 Puro-T2A-mCherry
Plasmid#238171PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA594 - pBA904 Puro-T2A-BFP
Plasmid#238170PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsmTagBFP2Available SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-2xFLAG-2xSTREP-E2F1
Plasmid#236436Purposestable expression of E2F1 using virus infectionDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Alpha-VA
Plasmid#191217PurposeLentiviral expression of SARS-CoV-2 Spike_Alpha in mammalian cellsDepositorInsertSPIKE_SARS2_Alpha (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationDel 69-70 Del 144 N501Y A570D D614G P681H T716I S…PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Beta-VA
Plasmid#191218PurposeLentiviral expression of SARS-CoV-2 Spike_Beta in mammalian cellsDepositorInsertSPIKE_SARS2_Beta (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationD80A D215G (Del 241-243) K417N E484K N501Y D614G …PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Delta-VA
Plasmid#191219PurposeLentiviral expression of SARS-CoV-2 Spike_Delta in mammalian cellsDepositorInsertSPIKE_SARS2_Delta (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationT19R 156del 157del R158G L452R T478K D614G P681R …PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Lambda-VA
Plasmid#191220PurposeLentiviral expression of SARS-CoV-2 Spike_Lambda in mammalian cellsDepositorInsertSPIKE_SARS2_Lambda (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationG75V T76I Del 246-252 L452Q F490S D614G T859NPromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_NSP3-VA
Plasmid#191214PurposeLentiviral expression of SARS-CoV-2 NSP3 in mammalian cellsDepositorInsertNon structural protein 3 (ORF1ab SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianPromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG Lenti CMV EGFP-HA Puro
Plasmid#236082PurposeLentiviral backbone expressing C-terminally HA tagged EGFP, control for empty backbone 236080DepositorInsertEGFP
UseLentiviralTagsHAPromoterCMVAvailable SinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-PGK-TetOn-Puro_MeltITSN1-37-mch
Plasmid#234068PurposeEncodes the Dbl homology and pleckstrin homology (DH-PH) domain of Intersectin1 controlled by a Melt variant with a switching temperature of 37°CDepositorInsertMeltITSN1-37-mCherry
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
XZ076 (PB) CMV-mCCL20 (PuroR-BFP)
Plasmid#233433PurposePiggyBac donor plasmid, membrane-bound CCL20DepositorInsertCCL20-pre-mGRASP
ExpressionMammalianMutationWTPromoterCMVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#1-puro
Plasmid#231984PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#2-puro
Plasmid#231983PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro human RLIM N581K
Plasmid#232242PurposeMammalian expression of Human RLIM N581KDepositorAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#2-puro
Plasmid#231982PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#1-puro
Plasmid#231981PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#2-puro
Plasmid#231980PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#1-puro
Plasmid#231979PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pScalps-Puro-FLAG_HA-Regnase-1 D141N
Plasmid#222663PurposeLentiviral vector to express mouse Regnase-1 D141N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12a (Zc3h12a Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationmutated aspartic acid 141 to asparagine to abroga…PromoterSFFVAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC1mut (N202P)
Plasmid#225455PurposeExpress mEGFP-fusion protein of FXR1 isoform a (N202P)DepositorAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-Puro_TAL1-long
Plasmid#210642PurposeOverexpression of TAL1-longDepositorAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-EGFP-FXR1-C (379-621)
Plasmid#225451PurposeExpress mEGFP-fusion protein of FXR1 isoform a (FXR1 fragment (379-621))DepositorInsertFXR1 isoform a (FXR1 Human)
TagsmEGFPExpressionMammalianMutationC terminal fragment (379-621)PromoterCMVAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-E-cadherin(Canis)-exon1 6-28 gRNA
Plasmid#209922PurposeA knock-out vector for the dog CDH1DepositorInsertA gRNA targeting the dog CDH1 gene.
UseCRISPR and LentiviralAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-miRFP703-eDHFR(69K6)-cRaf
Plasmid#209919PurposeMammalian expression of cRaf fused to miRFP703-eDHFR(69K6)DepositorInsertmiRFP703-eDHFR(69K6)-cRaf (RAF1 Human)
ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11-MMEJ
Plasmid#227333PurposeMMEJ Donor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Short Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro-PLK4
Plasmid#227311PurposeDonor template for mStayGold-EFS-Puro insertion into the C-terminus of the PLK4 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px458-PLK4 (Addgene #227310)DepositorInsertPLK4 Homology Arms flanking a mStayGold-EFS-Puro Cassette (PLK4 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro-CEP192
Plasmid#227290PurposeDonor template for mStayGold-EFS-Puro insertion into the C-term of CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold-EFS-Puro Cassette (CEP192 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pScalps-Puro-FLAG-HA-Regnase-3 D252N
Plasmid#222664PurposeLentiviral vector to express mouse Regnase-3 D252N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12c (Zc3h12c Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationmutated aspartic acid 252 to asparagine to abroga…PromoterSFFVAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC1-CC1
Plasmid#225458PurposeExpress EGFP-fusion protein of FXR1 isoform a (CC1-CC1)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsEGFPExpressionMammalianMutationCC2 replaced with a second copy of CC1PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC2mut (V361P)
Plasmid#225456PurposeExpress mEGFP-fusion protein of FXR1 isoform a (V361P)DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only