We narrowed to 18,030 results for: ERG
-
Plasmid#103305PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-193a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-193a-3p target (MIR193A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-142-5p
Plasmid#103241PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-142-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-142-5p target (MIR142 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF0544
Plasmid#141641PurposeLentiviral vector for overexpressing the ZFAT transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
NME2 gRNA (BRDN0001487089)
Plasmid#77932Purpose3rd generation lentiviral gRNA plasmid targeting human NME2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
mIFP12-Clathrin-15
Plasmid#56249PurposeLocalization: Clathrin Vesicles, Excitation: 683, Emission: 704DepositorAvailable SinceApril 28, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-143-5p
Plasmid#103243PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-143-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-143-5p target (MIR143 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146019)
Plasmid#75540Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146281)
Plasmid#75541Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
PNKP gRNA (BRDN0001147028)
Plasmid#77162Purpose3rd generation lentiviral gRNA plasmid targeting human PNKPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKRA gRNA (BRDN0001146443)
Plasmid#76299Purpose3rd generation lentiviral gRNA plasmid targeting human PRKRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA5 gRNA (BRDN0001145521)
Plasmid#77372Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW/TOPO-ELK1
Plasmid#98616PurposeGateway entry TOPO TA cloning vector for ELK1DepositorAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-579-5p
Plasmid#103661PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-579-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-579-5p target (MIR579 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-302c-3p
Plasmid#103403PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-302c-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-302c-3p target (MIR302C Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001487050)
Plasmid#77956Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ZAP70 gRNA (BRDN0001145290)
Plasmid#77957Purpose3rd generation lentiviral gRNA plasmid targeting human ZAP70DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTBK2 gRNA (BRDN0001487117)
Plasmid#77969Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTBK1 gRNA (BRDN0001145252)
Plasmid#75801Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTBK1 gRNA (BRDN0001148007)
Plasmid#75803Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only