We narrowed to 9,273 results for: mel

#187294

This is Caspase1 from mouse (NM_009807.2) with its CARD domain replaced by the FKBP-V domain (dimerising domain).

Alpha Yap

Bonfim-Melo et al Cell Rep. 2022 Feb 1;38(5):110316. doi:

July 12, 2024

Academic Institutions and Nonprofits only

#84006

Donor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4

Phillip Zamore

Ge et al G3 (Bethesda). 2016 Aug 26. pii: g3.116.

Nov. 8, 2016

Academic Institutions and Nonprofits only

#176679

Expression of Drosophila codon optimized spCas9 under Drosophila Act5C promoter

Norbert Perrimon

Viswanatha et al Nat Commun. 2021 Nov 24;12(1):6825. doi:

Nov. 23, 2021

Academic Institutions and Nonprofits only

#110121

Expresses Flag-tagged D. melanogaster Hel25E with K91N mutation that greatly reduces helicase activity

Jeremy Wilusz

Huang et al Genes Dev. 2018 May 17. pii: gad.314856.

Sept. 27, 2020

Academic Institutions and Nonprofits only

#110120

Expresses Flag-tagged D. melanogaster Hel25E with D193E mutation that greatly reduces ATP binding affinity

Jeremy Wilusz

Huang et al Genes Dev. 2018 May 17. pii: gad.314856.

Sept. 27, 2020

Academic Institutions and Nonprofits only

#221821

Plasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frame

Quentin Gaudry

Mallick et al bioRxiv [Preprint]. 2024 Apr 14:2024.04.

Aug. 18, 2025

Academic Institutions and Nonprofits only

#221822

Plasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frame

Quentin Gaudry

Mallick et al bioRxiv [Preprint]. 2024 Apr 14:2024.04.

Aug. 18, 2025

Academic Institutions and Nonprofits only

#186662

Donor plasmid to endogenously tag Nbr gene in Drosophila melanogaster at the C-terminal.

Astrid Haase

Meng et al Nucleic Acids Res. 2022 May 27. pii: 659

July 25, 2022

Academic Institutions and Nonprofits only

#110122

Expresses Flag-tagged D. melanogaster Hel25E with 4 mutations that impact circRNA nuclear export activity

Jeremy Wilusz

Huang et al Genes Dev. 2018 May 17. pii: gad.314856.

Sept. 27, 2020

Academic Institutions and Nonprofits only