We narrowed to 4,510 results for: pes
-
Plasmid#128842PurposegRNA for targeting mouse Utf1 locus using CRISPR-cas techniqueDepositorInsertUtf1 gRNA (Utf1 Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSFG-TFII-I-GFP Y248&249F
Plasmid#22196DepositorInsertTFII-I (GTF2I Human)
UseRetroviralTagsGFPExpressionMammalianMutationChanged Tyrosines 248 and 249 to Phenylalanines. …Available SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail - delta Y
Plasmid#60393PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) without Cterminal tyrosine (delta Y)DepositorInsertTUB1 (TUB1 Budding Yeast, Synthetic)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4)PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSFV_Nb139-NLS-VP64 (3'UTR)_RLEloop
Plasmid#240256PurposeAttenuated PROTEUS vector with Nb139-VP64 transgene. Package VLVs with an envelope-expressing vector such as pCMV-VSV-G, or a transgene-responsive VSV-G expression vector.DepositorInsertnanobody Nb139
TagsNLS-VP64ExpressionMammalianMutationVP64 = 4*VP16[aa437-447]PromoterSFV subgenomic promoterAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-HA-UBA7-Trp311*
Plasmid#251244PurposeExpression of UBA7 with nonsense mutation (Trp311 Stop)DepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGuide-NTRK1
Plasmid#246657PurposeGuide RNA for human NTRK1DepositorInsertNTRK1 guide RNA (NTRK1 Human)
UseCRISPRAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-FLAG-coK8
Plasmid#235542PurposeTo express tagBFP-2A-FLAG-coK8 (co = codon-optimized)DepositorInsertK8
UseLentiviralTagsFLAGAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-tagBFP-2A-coICP0-∆USP7
Plasmid#235540PurposeTo express tagBFP-2A-coICP0-∆USP7 (ICP0 ∆618-633, co = codon-optimized)DepositorInsertICP0-∆USP7
UseLentiviralMutationDeletion of region ∆618-633.Available SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAD131_hIrg1_M154I_pCMV6
Plasmid#239120PurposehACOD1 with M154I mutation in mammalian expression vectorDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
TagsMyc and FLAGExpressionMammalianMutationM154IPromoterCMVAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmBorealin-OLLAS
Plasmid#237439PurposeExpresses mouse Borealin tagged with OLLAS at C-term; made for in vitro transcription (T7 promoter)DepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313-rad53-5004
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-copGFP-v2-no-scaffold
Plasmid#228520PurposeCROP-seq-puro-v2 with scaffold sequence removed for the insertion of CRISPRmap Opool with guide, scaffold and barcode sequences, using copGFP as selection markerDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3-HA_full-length
Plasmid#222656PurposeMammalian expression vector to express full-length Regnase-3 tagged with FLAG at N-term and HA at C-termDepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57 mini-FLAG-HA-Regnase-3 WT
Plasmid#222651PurposeFor in vitro transcription of mouse Zc3h12c tagged with FLAG-HA at N-termDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
Plasmid#217509PurposeKD Recombinase dependent conditional 1X ALFA cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
TagsALFA tagExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_MSX1-FKBP-mNeonGreen-V5
Plasmid#215025PurposeAAV vector for knocking in a C-terminal tag (FKBP12F36V, mNeonGreen, and V5) for human MSX1DepositorAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCas-mut4/1_2_VB
Plasmid#186444PurposeEncodes Cas4(K81A)/1, Cas2, leader, repeat and one spacer from A. acidoterrestris (type V-B)DepositorInsertCas4/1 and Cas2
UseCRISPRMutationCas4 domain (K81A)PromoterT7Available SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT22gCfpUbiG4FER4P2A(#249)
Plasmid#184070Purposecyclofen-inducible GAL4 activation in zebrafish permanent transgenicDepositorInsertGal4bdFF-ERT2-P2A
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only