We narrowed to 1,471 results for: cag promoter
-
Plasmid#59187PurposeG10 promoting Glycing Max codon optimized Cas9 (N and C terminus NLS) with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRTagsExpressionPlantMutationPromoterG10Available sinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
UseTagsExpressionMammalianMutationPromoterU6 (gRNA1) and H1 (gRNA2)Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cas9 MDC123
Plasmid#59184Purpose2x35S promoting Glycing Max codon optimized Cas9 with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRTagsExpressionPlantMutationPromoter2X35SAvailable sinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_B
Plasmid#72626PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
UseTagsExpressionMammalianMutationPromoterU6 (gRNA1) and H1 (gRNA2)Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_B
Plasmid#72621PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
UseTagsExpressionMammalianMutationPromoterU6 (gRNA1) and H1 (gRNA2)Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertATL3-sgRNA #2 (ATL3 Human)
UseLentiviralTagsExpressionMammalianMutationPromotermU6 promoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorInsertd5-HT2BR gRNA1 (CG42796 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Blasticidin XLone-eGFP
Plasmid#159754PurposeAAVS1 donor plasmid for targeted inducible eGFP expression in human cellsDepositorInsertall-in-one tet-on system
UseCRISPR and TALEN; Donor plasmid for targeted knoc…TagsExpressionMammalianMutationPromoterTRE3GS inducible promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-HA-AT1R-YFP
Plasmid#101659PurposeExpresses AT1R with HA tag and YFP in mammalian cells.DepositorInsertAngiotensin II type 1 receptor (AGTR1 Human)
UseTagsHA and YFP (Venus)ExpressionMammalianMutationPromoterCAG promoterAvailable sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-FLAG-AT2R-CFP
Plasmid#101660PurposeExpresses AT2R with FLAG tag and CFP in mammalian cells.DepositorInsertAngiotensin II type 2 receptor (AGTR2 Human)
UseTagsECFP and FLAGExpressionMammalianMutationPromoterCAG promoterAvailable sinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorInserthuman CD14 (CD14 Human)
UseTagsExpressionMammalianMutationPromotermouse Hb9 (Mnx1) 9kb promoter fragmentAvailable sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
PBGFAP-eGFP
Plasmid#40975DepositorInsertMouse GFAP promoter fragment
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-tRNA
Plasmid#161761PurposeMODULE B tRNA vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2303 - #91068)DepositorInsertgRNAs
UseTagsExpressionBacterialMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
UseTagsExpressionBacterialMutationPromoterCmYLCV PromoterAvailable sinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only