We narrowed to 15,910 results for: grna
-
Plasmid#8881DepositorPublicationInsertGFP
UseRNAi and RetroviralExpressionMammalianAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
PSUPER-344(hPot1)
Plasmid#11133DepositorInsertRNAi against human Protection of Telomeres 1 (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable sinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
KRD22_HBA1(HBA1reg-HBB-longHAs)
Plasmid#232403PurposeAAV production plasmid for HBA1 long HAs vector from Figs. 3-6 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank full HBA1-2A-YFP cassette. HAs are ~900bpDepositorExpressionMammalianAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide2
Plasmid#118167PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA2 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118164PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg1dCas9-KRAB-T2a-GFP
Plasmid#234882PurposeL1HS-silencing plasmid (CRISPRi gRNA1)DepositorPublicationInsertL1HS-silencing plasmid (CRISPRi gRNA1)
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable sinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6-PGK-hCD2
Plasmid#224294PurposeExpresses sgRNA from U6 promoter and human CD2 under PGKDepositorInsertU6 sgRNA cassette with CD2 under PGK promoter (CD2 Human)
UseCRISPR and RetroviralExpressionMammalianPromoterU6/PGKAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGC-Lb12-P1Bb
Plasmid#231387PurposeFor crRNA cloning with LbCas12a vectors for genome editing in ArabidopsisDepositorInsertU6-29
UseCRISPRExpressionPlantAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-CENPA
Plasmid#227282PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CENPA for knock-in.DepositorInsertsgRNA Targeting N-terminus of CENPA (CENPA Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 sgATG7
Plasmid#211534PurposeDeletes ATG7DepositorInsertsgATG7
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYZ960
Plasmid#187972PurposeTEF1p-Cas9(noBsmBI)-CYC1t and tRNA-GFP-SUP4t with 2µ-URA3DepositorInsertCas9 (codon optimized for human)
UseSynthetic BiologyTagsSV40ExpressionYeastPromoterTEF1Available sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYZ462
Plasmid#187970PurposeTEF1p-Cas9-CYC1t and SNR52p-Not1-SUP4tDepositorInsertCas9 (codon optimized for human)
UseSynthetic BiologyExpressionYeastPromoterTEF1Available sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYDE007
Plasmid#194152PurposesgRNA expression in A. baumannii for CRISPRi. Replicative plasmid, CarbR. Contains mrfp nontargeting control guide sequence.DepositorInsertsgRNA with mrfp control guide sequence
ExpressionBacterialPromoterJ23119Available sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
p8266 LentiCRISPR v2 hygro sgNT-1
Plasmid#193977PurposeExpression of spCas9 and non-targeting control sgRNADepositorInsertspCas9
UseLentiviralAvailable sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-9
Plasmid#193668PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shSLC2A1-1
Plasmid#193702PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shSLC2A1-2
Plasmid#193703PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#2/Cre
Plasmid#193210PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgAAVS1-HepmTurquoise2
Plasmid#192828PurposeExpresses sgRNA targeting AAVS1 (non-targeting control sgRNA for mouse) and mTurquoise2 from hepatocyte-specific promoterDepositorInsertmTurquoise2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only