We narrowed to 19,374 results for: Comp

#243793

Encodes for mammalian expression of TEV protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.

Cole DeForest

Gharios et al Nat Chem Biol. 2025 Oct 9. doi: 10.1038/

Oct. 10, 2025

Academic Institutions and Nonprofits only

#129603

In vivo visualization of Rab7 (can be used for colocalization studies)

Dorus Gadella

Chertkova et al bioRxiv (2020) 160374; doi: https://doi.

Jan. 7, 2020

Academic Institutions and Nonprofits only

#98829

In vivo visualization of actin cytoskeleton (can be used for colocalization studies)

Dorus Gadella

Chertkova et al bioRxiv (2020) 160374; doi: https://doi.

July 28, 2017

Academic Institutions and Nonprofits only

#216674

Expresses his-tagged N-terminus truncated TdT in E. coli hosts

Po-Min Chiang

Hsueh et al PLoS Biol. 2025 Dec 15;23(12):e3003537.

Nov. 11, 2025

Academic Institutions and Nonprofits only

#61762

Dual Color betaGlobin reporter to study splicing kinetics in vivo

Daniel Larson

Coulon et al Elife. 2014 Oct 1;3. doi: 10.7554/eLife.

Feb. 12, 2015

Academic Institutions and Nonprofits only

#208296

Expresses ABE8r in mammalian cells

Weixin Tang

Xiao et al Nat Biotechnol. 2024 Jan 2. doi: 10.1038

Jan. 2, 2024

Academic Institutions and Nonprofits only

#135964

Expresses SauriCas9, and cloning backbone for sgRNA

Yongming Wang

Hu et al PLoS Biol. 2020 Mar 30;18(3):e3000686. d

April 9, 2020

Academic Institutions and Nonprofits only

#211370

Packaging plasmid for v3 PE-eVLP production

David Liu

An et al Nat Biotechnol. 2024 Jan 8. doi: 10.1038

Jan. 12, 2024

Academic Institutions and Nonprofits only

#184403

pX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGAT

Robert Bradley

Udy et al Life Sci Alliance. 2021 Dec 8;5(3). pii:

May 20, 2022

Academic Institutions and Nonprofits only

#202677

Photoactivatable lipid biosensor

Gerry Hammond

Pacheco et al J Cell Biol. 2023 Feb 6;222(2):e20220409

July 5, 2023

Academic Institutions and Nonprofits only