We narrowed to 168,368 results for: addgene
-
Plasmid#181860PurposePart of FluoSTEP-RhoA biosensor; co-express with cpPKN-mRuby2-GFP1-10 (Addgene #181859).DepositorAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only
-
CRYZL1_pLENTI-CAG-IRES-GFP
Plasmid#177004PurposeMammalian lentiviral expression vector encoding CRYZL1DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
ETS2_pLENTI-CAG-IRES-GFP
Plasmid#177005PurposeMammalian lentiviral expression vector encoding ETS2DepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdestMB14_grh-1p-grh-1-gfp
Plasmid#177761PurposeOverexpression of C. elegans grh-1DepositorInsertgrh-1 (grh-1 Nematode)
ExpressionWormAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdestMB14_hsp-16.2p-grh-1-gfp
Plasmid#177762PurposeOverexpression of C. elegans grh-1DepositorInsertgrh-1 (grh-1 Nematode)
ExpressionWormAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgAgo2_Nterm
Plasmid#170920PurposeExpresses spCas9 and sgRNA targeting the N-terminus of Ago2 for N-terminal taggingDepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgAgo1_Nterm
Plasmid#170921PurposeExpresses spCas9 and sgRNA targeting the N-terminus of Ago1 for N-terminal taggingDepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB131
Plasmid#180174PurposepAAV construct GluN1A714L (shRNA resistant)DepositorAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-Chpt1
Plasmid#175155PurposeLentiviral expression of V5-tagged mouse Chpt1DepositorAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pStr-KDEL_EPV-CXCL9-mCherry-SBP
Plasmid#170678PurposeExpresses ER-targeted streptavidin-KDEL (hook) and CXCL9-mCherry-SBP targeted to the ER lumen with an N-terminal EPV tripeptide (cargo) for RUSH.DepositorInsertsTagsSBP and mCherryExpressionMammalianMutationChanged threonine 23 to glutamate (T23E)PromoterIRES and T7Available SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Dnajc16-V5
Plasmid#175156PurposeLentiviral expression of mouse Dnajc16-V5DepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Cdipt-V5
Plasmid#175144PurposeLentiviral expression of mouse Cdipt-V5DepositorAvailable SinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Tmx4-V5 C209A, C211A
Plasmid#175141PurposeLentiviral expression of V5-tagged mouse Tmx4DepositorAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-mRnf185
Plasmid#175126PurposeLentiviral expression of V5-tagged mouse Rnf185DepositorAvailable SinceJan. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV Tmem43-V5
Plasmid#175111PurposeLentiviral expression of mouse Tmem43-V5DepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only