We narrowed to 7,006 results for: Mag
-
Plasmid#246742PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationL115RPromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6 FLAG-DNAJC5 delL116
Plasmid#246741PurposeMammalian expression of human DNAJC5 with L115R mutation, and a FLAG tag on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsFLAGExpressionMammalianMutationdelL116PromoterCMVAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX GST-tev-hDNAJC5 delL116
Plasmid#246744PurposeBacterial expression of human DNAJC5 L116 deleted with GST and a cleavage site for TEV protease on its N-terminusDepositorInsertDNAJC5 (DnaJ heat shock protein family) (DNAJC5 Human)
TagsGSTExpressionBacterialMutationdelL116PromoterlacZAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E mCherry-T2A-hsHRAS-G12V-pA (JDW 1188)
Plasmid#242571PurposeGateway 3' entry clone containing mCherry followed by a T2A cleavage peptide and then human HRAS G12V.DepositorInsertHRAS-G12V (HRAS Human)
UseGateway subcloningAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Sun1-2xsfGFP-6xMYC-pA (JDW 694)
Plasmid#242588PurposeA CMV driven expression vector containing a Sun1-2xsfGFP for labeling nuclear envenlope.DepositorAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pME-V5-mTagBFP2-KRAS4A-WT (JDW 831)
Plasmid#242568PurposeGateway middle entry clone containing an mTagBFP2 fused human KRAS4A WT.DepositorInsertKRAS4A (WT) (KRAS Human)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only