We narrowed to 6,185 results for: cas9 expression plasmid
-
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7
Plasmid#226678PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2_8xCTS-ECFP
Plasmid#200249PurposeZebrafish transgenics; Plasmid encodes the sgRNA2_8xCTS-ECFP reporter and could be stably integrated in the zebrafish genome using Tol2 transgenesisDepositorInsert8xCTS-ECFP
UseZebrafish expressionAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE-4A6-vioC
Plasmid#73439PurposeDeoxyviolacein pathway (vioABEC) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variants G6 (vioABE) and 4A6 (vioC) for orthogonal flux redirection.DepositorInsertPG6-vioABE-P4A6-vioC
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6 and P4A6 (orthogonal T7-lac variants)Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
Plasmid#154430Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vectorDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
UseAAV and CRISPRExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAbaMCi-GFP-BsaI_pJMP2748
Plasmid#208888PurposeAcinetobacter baumannii CRISPRi test plasmid (GFP, BsaI cloning site in gRNA cassette).DepositorInsertdCas9, sgRNA expression cassette, sfGFP
UsePir dependent origin of replicationExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-LMNA-gRNA1
Plasmid#122507Purposeexpresses WT spCas9 and a chimeric gRNA targeting human LMNADepositorInsertLMNA-gRNA1
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only