We narrowed to 27,295 results for: ANT
-
Plasmid#176822PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert704
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE050
Plasmid#176807PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert601
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPgiCas13b
Plasmid#184833PurposeInducible expression of PgiCas13b nuclease in bacteria.DepositorInsertCas13b nuclease from Porphyromonas gingivalis
UseCRISPRExpressionBacterialPromoterT7 promoterAvailable SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTZ tRNA_gRNA empty scaffold
Plasmid#188450PurposeExpression of gRNAs using a human tRNA promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromotertRNA glutamineAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLBS.EF/miRFP670-hGem110Nt
Plasmid#129333PurposeCell cycle reporter, lentivirusDepositorInsertmiRFP670 (Addgene 80006)
UseLentiviralAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBXPHM3-PCFT_NB
Plasmid#165415PurposeExpression in E.coli of N terminally MBP tagged anti-GgPCFT nano bodyDepositorInsertGgPCFT_NB (SLC46A1 Chicken, Llama)
TagsHis10-MBP-3C protease siteExpressionBacterialPromoterarabinoseAvailable SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a Gx-NL3
Plasmid#169108PurposeExpresses protein G fused to 3 copies of NanoLuc. The protein G domain contains an amber stop-codon at position 24 for incorporation of the unnatural amino acid para-benzoylphenylalanine.DepositorInsertprotein G - NanoLuc - NanoLuc - NanoLuc
Tagshis-tag and strep-tagExpressionBacterialMutationAla 24 stopPromoterT7Available SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHCKAn-phoAp-GRFT
Plasmid#158747Purposelow phosphate phoAp induction of GriffithsinDepositorInsertphoAp Griffithsin
ExpressionBacterialPromoterphoAAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.13/GUG-FFLuc-3XFLAG
Plasmid#127334PurposeExpress 3xFLAG tagged firefly luciferase (FFLuc) from GUG start codonDepositorInsertFirefly luciferase
Tags3xFLAGExpressionMammalianPromoterSV40Available SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTEI165
Plasmid#126074PurposeVector for expression of plastid targeted improved YFP1-10 (T65G,T205S, T203Y) in plant cellDepositorInsertChloroplastic FNR transit peptide
UseBinaryTagsYFP1-10 (improved)ExpressionPlantAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJOG022
Plasmid#105384PurposeSynthetic biologyDepositorInsertpromotor Zea mays Ubiquitin (1500bp)
UseSynthetic BiologyMutationBsaI/ BpiI restriction sites removedAvailable SinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
UKNP6.1.2
Plasmid#98388PurposeExpression of HCV E1E2 genes cloned from patient serum. United Kingdom Nottingham Panel x.xx.xx (genotype.patient number.clone number)DepositorInsertHCV E1E2
ExpressionMammalianAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
UKNP1.4.1
Plasmid#97363PurposeExpression of HCV E1E2 genes cloned from patient serum. United Kingdom Nottingham Panel x.xx.xx (genotype.patient number.clone number)DepositorInsertHCV E1E2
ExpressionMammalianAvailable SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_U2AF1_WT
Plasmid#81954PurposeGateway Donor vector containing U2AF1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KLRC2_WT
Plasmid#81886PurposeGateway Donor vector containing KLRC2 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_SYCP1_WT
Plasmid#81828PurposeGateway Donor vector containing SYCP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_HAUS1_WT
Plasmid#81790PurposeGateway Donor vector containing HAUS1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_TMPO_p.D185H
Plasmid#81616PurposeGateway Donor vector containing TMPO , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_CCND1_WT
Plasmid#82262PurposeGateway Donor vector containing CCND1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only