We narrowed to 13,191 results for: BASE
-
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187963PurposemAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertsAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linker and T2AExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-ecDHFR-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187950PurposeecDHFR degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertecDHFR-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
ZJOM108
Plasmid#133665PurposeIntegration of mTagBFP2-Tlg1 as an additional copy in genome, use auxotrophic marker TRP1(Kluyveromyces lactis). Marker for yeast late golgi/early endosome.DepositorAvailable SinceApril 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb4-GFP KI
Plasmid#139663PurposeEndogenous tagging of CaVβ4: C-terminal (amino acid position: H417)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
ZJOM12
Plasmid#133638PurposeIntegration of GFP-TLG2 as an additional copy in genome, use auxotrophic marker URA3(Saccharomyces cerevisiae). Marker for yeast late golgi/early endosome.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJB332
Plasmid#115949PurposeORF insert for replicon MoCloDepositorInsertLvl0 TetR-Gly9-DDX6 (contains SapI)
UseSynthetic BiologyAvailable SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC0.017
Plasmid#119621PurposeLevel 0 Part. CDSDepositorInsertdCas9
UseSynthetic BiologyMutationbp 331 C to A , 1237 A to C, 1284 C to T, 2121 C …Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
KN901: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-KRAB
Plasmid#121830PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/KRAB (open)
UseGateway Cloning and Synthetic BiologyTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only