We narrowed to 208 results for: fga
-
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
UseTagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansPromoterAvailable sinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorInsertAICD-NES (APP Human)
UseAAVTagsExpressionMutationNonePromoterCMVAvailable sinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1
Plasmid#103860PurposeHeterologous, cobalt-inducible expression of SQE1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertsqualene epoxidase 1 (XF1 Mustard Weed)
UseSynthetic BiologyTagsExpressionBacterialMutationinserted gene is codon optimized. 2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available sinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-TGFa-EREG-ScNeo
Plasmid#209915PurposeTo express the chimeric protein of TGFα and EREG, which a recombinant TGFα protein fused extracellularly to the mScarlet and a recombinant Epiregulin protein fused intracellularly to the mNeonGreenDepositorUseTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianMutationPromoterAvailable sinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_THAS1
Plasmid#103859PurposeHeterologous, cobalt-inducible expression of SQE1 and THAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertthalianol synthase 1 (THAS1 Mustard Weed)
UseSynthetic BiologyTagsExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available sinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_MRN1
Plasmid#103858PurposeHeterologous, cobalt-inducible expression of SQE1 and MRN1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertmarneral synthase 1 (MRN1 Mustard Weed)
UseSynthetic BiologyTagsExpressionBacterialMutationinserted genes are codon optimized2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available sinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_CAS1
Plasmid#103856PurposeHeterologous, cobalt-inducible expression of SQE1 and CAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertcycloartenol synthase 1 (CAS1 Mustard Weed)
UseSynthetic BiologyTagsExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available sinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
GAP50-COMP-blac-flag-his
Plasmid#110956PurposeExpresses pentamerised full-length protein ectodomain with no N-linked glycans in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag, COMP pentamerisation domain, flag- and 6xHis tags.DepositorInsertsecreted acid phosphatase (GAP50) (PF3D7_0918000 Synthetic)
UseTagsExogenous signal peptide of mouse origin and rat …ExpressionMammalianMutationAll NXT/S sites mutated to NXA, where X is any am…PromoterCMVAvailable sinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only