We narrowed to 1,471 results for: cag promoter
-
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PIK3R1 sgSTOP
Plasmid#100714PurposeB52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PIK3R1 (cloned using BbsI)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCrx-DsRed
Plasmid#13765DepositorInsertCrx promoter (Crx Mouse)
UseTagsDsRed2ExpressionMammalianMutationPromoterAvailable sinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-miRFP703-dSal-VP16minADx3-hCRY2-NLS
Plasmid#241843PurposeExpresses an actuator of Opto-p53 in mammalian cells.DepositorInsertVP16
UseTagsCRY2 and miRFP703ExpressionMammalianMutationVP16 minimal activation domain x 3PromoterCAGGS promoterAvailable sinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVTagsExpressionMutations1006-gggs-d1221 deletionPromoterAvailable sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDF0428 huDisCas7-11-R1045-GGGS-R1122-U6-pro-Gluc
Plasmid#186985PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, Gluc crRNA guide
UseAAVTagsExpressionMutationr1045-gggs-r1122 deletionPromoterAvailable sinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PDL1
Plasmid#159280PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInsertHuman PDL1/CD274 (CD274 Human)
UseAAV; S1 knockin donor vectorTagsExpressionMammalianMutationPromoterCAGGSAvailable sinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorInsertsgNkx2-1#1 (Nkx2-1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
msEGFP-PACR_pRSETB
Plasmid#55775PurposeGenetically encoded caged Ca2+DepositorInsertPACR
UseTags6xHis and msEGFPExpressionBacterialMutationPromoterT7 promoterAvailable sinceJuly 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralTagsExpressionMammalianMutationPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
hROSA26 CRISPR-pX330
Plasmid#105927PurposehROSA26 targeting CRISPR plasmidDepositorInserthROSA26 gRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only