We narrowed to 9,786 results for: Coli
-
Plasmid#101194PurposeExpresses a Ferritin-Dronpa fusion construct in E. coliDepositorInsertFerritin-Dronpa
Tags6xHis, T7 tag, and Xpress tagExpressionBacterialPromoterT7Available SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-SS-352
Plasmid#68791PurposeZF9 Op x6 -- GFP-IRES-NTRDepositorInsertsZF9 Op 6x
EGFP
Nitroreductase
TagsIRESExpressionMammalianAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUMV19
Plasmid#67161Purposeinducible operation of the mevalonate pathway in E. coliDepositorInsertthe mevalonate pathway genes
ExpressionBacterialPromoterlacZAvailable SinceOct. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNIC-CFP
Plasmid#173074PurposeExpression vector for E. coli producing target protein with N-terminal CFP fusionDepositorTypeEmpty backboneTagsmCeruleanExpressionBacterialAvailable SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(+6)
Plasmid#199160Purposeused to express a supercharged GFP variant in E. coliDepositorInsertGFP(+6)
TagsMGHHHHHHGGAMutationE16R, D86K, D112K, D127R, I138R, D207R, N222K, L2…PromoterT7Available SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBSV2_2
Plasmid#118226PurposeEmpty E. coli - B. burgdorferi shuttle vector; kanamycin resistantDepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_LolT_C41S
Plasmid#211789PurposeExpression plasmid in E. coli BL21(DE3) , which can be used for expression and purification to get protein LolT_C41SDepositorInsertlolt mutant
TagsHis tagExpressionBacterialPromoterT7 promoterAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-J23110-B0034-mRFP1_Magenta
Plasmid#160446PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses mRFP1_Magenta chromoprotein in E. coliDepositorInsertpromoter, RBS, mRFP1E_Magenta
UseSynthetic BiologyMutationBioBrick sites removedAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET51b_SNAP-ecDHFR
Plasmid#187108PurposeExpression of SNAP-ecDHFR fusion in bacteriaDepositorInsertSNAP-ecDHFR
TagsHisx10 and StrepExpressionBacterialPromoterT7Available SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only