We narrowed to 1,457 results for: tox
-
Plasmid#187426PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorExpressionInsectMutationchanged aspartic acid at 129 for histidinePromoterPH and p10Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only
-
RAT +R111E
Plasmid#187425PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cellsDepositorExpressionInsectMutationchanged arginine at 118 to glutamic acidPromoterPH and p10Available SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2CpolyGly op GFP (NIID)
Plasmid#224356PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with an expansion (100x) of GGC repeats with codon optimization (NOT pure GGC repeats)DepositorInsertuN2C with a GGC repeat expansion (100x)
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intron (CAG)Available SinceFeb. 5, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-N1-HPGD-FLAGC
Plasmid#161915PurposeExpresses human HPGD with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-BRAT1
Plasmid#161920PurposeExpresses human BRAT1 with a N-terminal GFP-FLAG tag. Confers G418 resistance.DepositorInsertBRCA1-associated ATM activator 1 (BRAT1 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-WT-FLAGC
Plasmid#161903PurposeExpresses human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInserthydroxysteroid 17-beta dehydrogenase 11 (HSD17B11 Human)
TagsFLAG-GFPExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B13-WT-FLAGC
Plasmid#184501PurposeExpresses human HSD17B13 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 13 (HSD17B13 Human)
TagsFLAGC-GFPExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Neo-CMV>hCCNL2
Plasmid#239219PurposeExpresses CCNL2 in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11B
Plasmid#239211PurposeExpresses CDK11B in mammalian cell linesDepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Bsd-CMV>hCDK11A G567S
Plasmid#239214PurposeExpresses CDK11A with G567S resistance mutation in mammalian cell linesDepositorInsertcyclin dependent kinase 11A with G567S resistance mutation (CDK11A Human)
UseLentiviralExpressionMammalianMutationchanged Glycine 567 to SerineAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCARgsg(anti-CD19)
Plasmid#215759PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2 (enhanced expression by GSG-2A linker)DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-V16D-FLAGC
Plasmid#184500PurposeExpresses the V16D mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 11 (HSD17B11 Human)
TagsFLAGC-GFPExpressionMammalianMutationV16DPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-L14P-FLAGC
Plasmid#184499PurposeExpresses the L14P mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInsert17-beta-hydroxysteroid dehydrogenase 11 (HSD17B11 Human)
TagsFLAGC-GFPExpressionMammalianMutationL14PPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-HSD17B11-S172L-FLAGC
Plasmid#161904PurposeExpresses the catalytically inactive S172L mutant of human HSD17B11 with a C-terminal FLAG-GFP tag. Confers G418 resistance.DepositorInserthydroxysteroid 17-beta dehydrogenase 11 (HSD17B11 Human)
TagsFLAG-GFPExpressionMammalianMutationS172L; catalytically dead mutantPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only