We narrowed to 45,012 results for: cha
-
Plasmid#171923PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4-WPRE-UbC-Emerald
Plasmid#225943PurposeLentiviral vector plasmid expressing human cytoskeleton associated protein 4 (CKAP4) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-3UAG
Plasmid#82501PurposeExpresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153DepositorInsertGreen Fluorescence Protein with 3 UAG codons
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3, …PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 Flag-LplA
Plasmid#232118PurposeFor bacterial expression of Flag-tagged E. coli LplA.DepositorInsertlplA (lplA Escherichia coli (strain K12))
TagsFlagExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MTS-KD-c-Src-FLAG
Plasmid#44653DepositorInsertv-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) (SRC) (SRC Human)
TagsFLAG tag and mitochondria-targeting sequence (MTS…ExpressionMammalianMutationchanged lysine 298 to methioninePromoterCMV promoterAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Cx32R220stop
Plasmid#78151PurposeMammalian Expression of the first 219 amino acids of Connexin 32 and EGFP from a bicistronic mRNADepositorInsertConnexin 32 (GJB1 Human)
TagsEGFPExpressionMammalianMutationOnly contains first 219 residuesPromoterCMVAvailable SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
YA1531: pAAV_CAG-FLEX-QuasAr3
Plasmid#107701Purposein vivo voltage imagingDepositorInsertQuasAr3
UseAAVExpressionMammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Nsp14-mCherry
Plasmid#165137Purposemammalian expression and localizationDepositorAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only