We narrowed to 45,012 results for: cha

#55824

Expresses S586A VLCAD mutant in mammalian cells

Yoshimi Homma

Kabuyama et al Am J Physiol Cell Physiol. 2010 Jan;298(

July 14, 2014

Academic Institutions and Nonprofits only

#139326

Plasmid expressing a sgRNA to introduce BRCA1 C64Y using base editing

Alberto Ciccia

Billon et al Cell Rep. 2020 Mar 10;30(10):3280-3295.e

May 22, 2020

Academic Institutions and Nonprofits only

#99615

To clone gene of interest downstream of LoxP3-Mb2-HA-mTFP1-2A

Rui Benedito

Pontes-Quero et al Cell. 2017 Aug 10;170(4):800-814.e18. do

Sept. 7, 2017

Academic Institutions and Nonprofits only

#60012

Expresses TFAM No MTS L6 mutant in bacterial cells

David Chan

Ngo et al Nat Commun. 2014;5:3077. doi: 10.1038/nc

Oct. 21, 2014

Academic Institutions and Nonprofits only

#110853

Lentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized)

Lukas Dow

Zafra et al Nat Biotechnol. 2018 Jul 3. pii: nbt.419

June 27, 2018

Academic Institutions and Nonprofits only

#87402

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#107920

LEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacer

Jean-Marc Daran

Mans et al FEMS Yeast Res. 2015 Mar;15(2). pii: fov

April 18, 2018

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only