We narrowed to 170,787 results for: Gene
-
Plasmid#239894PurposeCaMV 35S-SynPro-07 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-07::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
yTREX-ApR
Plasmid#177307Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5DepositorTypeEmpty backboneUseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW21K_1Ti1
Plasmid#177291Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcR and eYFPDepositorInserteYFP
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW27K_7Ti1
Plasmid#177294Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcR and LacZDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTSK56K_3G7
Plasmid#177301Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTSK58K_6G7
Plasmid#177302Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR and PE-HDepositorInsertpe-h
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTSK65K_8G7
Plasmid#177303Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn7 with GmR and GUSDepositorInsertuidA
UseSynthetic Biology; Yeast expression, tn7 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW07K_0G5
Plasmid#177279Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmRDepositorInsertPaacC1-aacC1
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW08K_0C5
Plasmid#177280Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with CmRDepositorInsertPcat-cat
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW11K_0S5
Plasmid#177282Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with SmRDepositorInsertPaadA-aadA
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW14K_7G5
Plasmid#177283Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW15K_2G5
Plasmid#177284Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and mTagBFP2DepositorInsertmTagBFP2
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW17K_6G5
Plasmid#177285Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and PE-HDepositorInsertpe-h
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW16K_1G5
Plasmid#177286Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and eYFPDepositorInserteYFP
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW13K_3G5
Plasmid#177287Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW18K_3T5
Plasmid#177288Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW20K_0Ti1
Plasmid#177289Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW28K_0Ti1
Plasmid#177290Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcRDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235301PurposeComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235302PurposeComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-EGFP-FMRP-bGH
Plasmid#235265PurposeComMAND EGFP-FMRP base geneDepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseSynthetic BiologyTagsFLAGExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-TAZ-CAMTA1
Plasmid#235679PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-35S
Plasmid#226706PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-UBI
Plasmid#226707PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA8
Plasmid#196103PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196106, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA19-HSPB1 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#199450PurposeCRISPR donor plasmid to insert TriTag (mTagBFP harbors 12XMS2 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA20-HSPB1 5'HA-mTagBFP-3'-UTR 12XMS2V5-3'HA (HDR donor)
Plasmid#199451PurposeCRISPR donor plasmid to insert [mTagBFP-stop-12XMS2] into the C-terminus of human HSPB1 gene; 12XMS2 locates in the 3' UTR regionDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA21-HSPB1 5'HA-NarTag (12XPP7)-3'HA (HDR donor)
Plasmid#199452PurposeCRISPR donor plasmid to insert NarTag (mTagBFP harbors 12XPP7 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins1
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-PGK-dt/CBA-EGFP-NLS
Plasmid#163918PurposeContains bidirectional reporter genes dtomato and nuclear-targeting EGFP.DepositorInsertdtomato and EGFP
UseLentiviralExpressionMammalianMutationAdded nuclear localization signal to EGFPAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only