We narrowed to 167,150 results for: Gene
-
Plasmid#177280Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with CmRDepositorInsertPcat-cat
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW11K_0S5
Plasmid#177282Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with SmRDepositorInsertPaadA-aadA
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW14K_7G5
Plasmid#177283Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and LacZDepositorInsertlacZ
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW15K_2G5
Plasmid#177284Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and mTagBFP2DepositorInsertmTagBFP2
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW17K_6G5
Plasmid#177285Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and PE-HDepositorInsertpe-h
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW16K_1G5
Plasmid#177286Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and eYFPDepositorInserteYFP
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW13K_3G5
Plasmid#177287Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with GmR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW18K_3T5
Plasmid#177288Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5 with TcR and mCherryDepositorInsertmCherry
UseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW20K_0Ti1
Plasmid#177289Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon with TcRDepositorInsertPtet-tetA(C)
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW28K_0Ti1
Plasmid#177290Purposegenomic integration of genes (inserted in I-SceI-site) via rrn-interposon/SacB with TcRDepositorInsertPsacB-sacB
UseSynthetic Biology; Yeast expression, rrn genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235301PurposeComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235302PurposeComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-EGFP-FMRP-bGH
Plasmid#235265PurposeComMAND EGFP-FMRP base geneDepositorInsertEGFP-Fmr1 (Fmr1 Mouse)
UseSynthetic BiologyTagsFLAGExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-TAZ-CAMTA1
Plasmid#235679PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-35S
Plasmid#226706PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-UBI
Plasmid#226707PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA8
Plasmid#196103PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196106, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA19-HSPB1 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#199450PurposeCRISPR donor plasmid to insert TriTag (mTagBFP harbors 12XMS2 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA20-HSPB1 5'HA-mTagBFP-3'-UTR 12XMS2V5-3'HA (HDR donor)
Plasmid#199451PurposeCRISPR donor plasmid to insert [mTagBFP-stop-12XMS2] into the C-terminus of human HSPB1 gene; 12XMS2 locates in the 3' UTR regionDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA21-HSPB1 5'HA-NarTag (12XPP7)-3'HA (HDR donor)
Plasmid#199452PurposeCRISPR donor plasmid to insert NarTag (mTagBFP harbors 12XPP7 in its intron) into the C-terminus of human HSPB1 geneDepositorInsertHDR donor template
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins1
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-PGK-dt/CBA-EGFP-NLS
Plasmid#163918PurposeContains bidirectional reporter genes dtomato and nuclear-targeting EGFP.DepositorInsertdtomato and EGFP
UseLentiviralExpressionMammalianMutationAdded nuclear localization signal to EGFPAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
SL542
Plasmid#49951PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
SL544
Plasmid#49970PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL545
Plasmid#49953PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL543
Plasmid#49952PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL541
Plasmid#49950PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
SL540
Plasmid#49949PurposeExpresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human RHOXF2/2B homeobox (RHOXF2) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUK21
Plasmid#49788PurposeE. coli cloning vector (KanR, high copy, blue/white selection, M13 IR)DepositorTypeEmpty backboneUseCloning vectorPromoterlacZAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCIneoEGFP
Plasmid#46949PurposeGFP in Promega pCIneo (uses CMV promoter). Superior to pfwB for some purposesDepositorInsertGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIB2
Plasmid#25451DepositorInsertPichia pastoris HIS4 (PAS_chr1-4_0160 Pichia pastoria)
UsePichia pastoris expressionAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIB4
Plasmid#25453DepositorInsertPichia pastoris HIS4 (PAS_chr1-4_0160 Pichia pastoria)
UsePichia pastoris expressionAvailable SinceFeb. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pIB3
Plasmid#25452DepositorInsertPichia pastoris HIS4 (PAS_chr1-4_0160 Pichia pastoria)
UsePichia pastoris expressionAvailable SinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pKEN GFP mut3
Plasmid#20410DepositorInsertGFP
ExpressionBacterialMutationS65G S72AAvailable SinceMarch 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBI-MCS-EGFP
Plasmid#16542DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDASH-AIK
Plasmid#242525PurposeAcceptor vector I, accepting Donor I first, with attPTT-FRTDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLZts
Plasmid#128799PurposeTemperature-sensitive vector for allelic replacement mutagenesis of Group A StreptococcusDepositorTypeEmpty backboneUseBacterial mutagenesisAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLPT107
Plasmid#85525PurposeRepressilator with triple reporterDepositorInsertsmCfp
mVenus
tetR
lacI
cI
mKate2
UseSynthetic BiologyTagsssrAExpressionBacterialAvailable SinceApril 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINK-EF1alpha-HA-5'-UNC13A
Plasmid#244344Purpose5' AAVLINK plasmid for UNC13A expressionDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Gateway
Plasmid#32671DepositorTypeEmpty backboneUseAAV; AavAvailable SinceJune 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pQFT-mNG
Plasmid#203675PurposepQFT with mNeonGreen under control of PQJDepositorInsertmNeonGreen
ExpressionBacterialPromoterPQJAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYY10-2µ-TP901
Plasmid#235771Purpose2µ plasmid for constitutive expression of TP901 under RNR2 promoter.DepositorInsertTP901 integrase
ExpressionYeastAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only