We narrowed to 14,247 results for: RON
-
Plasmid#127601Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 3P-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins inserted near 3′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-5M-ECM33_intron
Plasmid#127600Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 5M-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins replacing sequence near 5′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-5P-ECM33_intron
Plasmid#127599Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 5P-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins inserted near 5′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-ECM33_intron
Plasmid#127598Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, ECM33 intron inserted into URA3DepositorInsertECM33 intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL405 CHYRON1 integration construct
Plasmid#126442PurposeTo integrate the CHYRON1 locus at HEK293site3.DepositorInsertspU6-CHYRON1 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6Available SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.Intron9.CMV/CB-EGFP
Plasmid#121509PurposeExpresses sgRNA targeting mouse Fah intron 9 (sgFah.Intron9).DepositorInsertsgFah.intron9
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRRP51A+intron-LacZ (pHZ18)
Plasmid#33131DepositorInsertRP51A+intron-LacZ (RPS17A Budding Yeast)
ExpressionYeastAvailable SinceDec. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcFNE3A (chick fibronectin E3A)
Plasmid#14062DepositorInsertChicken Fibronectin EIIIA (FN1 Chicken)
ExpressionMammalianMutationBlunted BstE2-AvaII fragment was inserted into bl…Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcFNE3B (chick fibronectin E3B)
Plasmid#14064DepositorInsertChicken Fibronectin EIIIB (FN1 Chicken)
ExpressionMammalianAvailable SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFastBac His6 MBP TEV cloning vector with BioBrick polycistronic restriction sites (11C)
Plasmid#48296DepositorTypeEmpty backboneTagsHis6 and MBPExpressionInsectAvailable SinceSept. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Thioredoxin TEV cloning vector with BioBrick polycistronic restriction sites (9T)
Plasmid#48292DepositorTypeEmpty backboneTagsHis6 and ThioredoxinExpressionBacterialAvailable SinceSept. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLN189 (SSX1p-[mK-Ex1]-[miR1-Mv2 intron]-[mK-Ex2]-BS(Pe))
Plasmid#105209PurposeModule 1 - SSX1 promoter drives self-inhibiting mKate2 expression (Version 2 intron - see PMID: 29056342 for detailed information)DepositorInsertSSX1p-[mK-Ex1]-[miR1-Mv2 intron]-[mK-Ex2]-BS(Pe)
UseSynthetic BiologyExpressionMammalianAvailable SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-ZKSCAN1 548-1417 (No intron)
Plasmid#69904PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cellsDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PP_080_pAAV_CAG_DIO-LR-Voltron2-P2A-CheRiff-eGFP-ST (Kv2.1TS)
Plasmid#230990PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized Voltron2 and soma-localized CheRiff
UseAAVExpressionMammalianPromoterCAGAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Sec61b WPRE
Plasmid#236229PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-STIM2 WPRE
Plasmid#236236PurposeAAV expression of human STIM2 internally tagged with mScarlet-IDepositorInsertmScarletI-STIM2 (STIM2 Human)
UseAAVTagsmScarletI in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Fibronectin-human-mutated N-terminal (N), V1 and V2 Glycosylation sites
Plasmid#120407Purposeenables eukaryotic expression of human plasma fibronectin in which all three O-glycosylation sites were mutated from threonine to serineDepositorInsertFibronectin (FN1 Human)
ExpressionMammalianMutationContains complete variable region with mutations …PromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only