We narrowed to 13,191 results for: BASE

#113689

SaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS

Jonathan Ploski

Kumar et al Front Mol Neurosci. 2018 Nov 13;11:413.

Dec. 20, 2018

Academic Institutions and Nonprofits only

#114088

U6 promoter crRNA entry vector used for all MbCas12a crRNAs (clone spacer oligos into BsmBI cassette)

Keith Joung, Benjamin Kleinstiver

Kleinstiver et al Nat Biotechnol. 2019 Feb 11. pii: 10.103

Dec. 10, 2018

Academic Institutions and Nonprofits only

#114090

CAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tag

Keith Joung, Benjamin Kleinstiver

Kleinstiver et al Nat Biotechnol. 2019 Feb 11. pii: 10.103

Dec. 10, 2018

Academic Institutions and Nonprofits only

#100169

Used to improve production from engineered biosynthetic pathways include optimizing codon usage, enhancing production of rate-limiting enzymes, and eliminating the accumulation of toxic intermediates or byproducts to improve cell growth

Jay Keasling

Anthony et al Metab Eng. 2009 Jan;11(1):13-9. doi: 10.

Sept. 15, 2017

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87407

p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#61359

encodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation 1645/1646 RR/EE) driven by CMV promoter

Charles Gersbach

Hilton et al Nat Biotechnol. 2015 May;33(5):510-7. do

April 10, 2015

Academic Institutions and Nonprofits only

#111406

pScaf phagemid with insert for generating DNA origami scaffold 7560 bases in length

Shawn Douglas

Nafisi et al Synth Biol (Oxf). 2018 Jan;3(1). doi: 10

Aug. 16, 2018

Academic Institutions and Nonprofits only