We narrowed to 13,284 results for: sequence

#11906

David Bartel

Lewis et al Cell. 2003 Dec 26. 115(7):787-98.

April 27, 2007

Academic Institutions and Nonprofits only

#120787

Part of GoldenGate Yarrowia lipolytica toolkit for assembling an expression plasmid for Y. lipolytic yeast. Sequence for integration into Y. lipolytica genome, randomly or at zeta platforms. Linearization of cassette by SfiI restriction enzyme after the assembly

Tristan Rossignol

Larroude et al Microb Biotechnol. 2019 May 31. doi: 10.

Nov. 12, 2019

Academic Institutions and Nonprofits only

#120786

Part of GoldenGate Yarrowia lipolytica toolkit for assembling an expression plasmid for Y. lipolytic yeast. Sequence for integration into Y. lipolytica genome, randomly or at zeta platforms. Linearization of cassette by SfiI restriction enzyme after the assembly

Tristan Rossignol

Larroude et al Microb Biotechnol. 2019 May 31. doi: 10.

Nov. 12, 2019

Academic Institutions and Nonprofits only

#175045

Generation of MS2 Virus-Like Particles packaged with the sequence for the WHO Alpha SARS-CoV-2 S gene (Amino Acid 319-869)

Paul Freemont

Oct. 18, 2021

Industry, Academic Institutions, and Nonprofits

#175046

Generation of MS2 Virus-Like Particles packaged with the sequence for the WHO Beta SARS-CoV-2 S gene (Amino Acid 319-869)

Paul Freemont

Oct. 18, 2021

Industry, Academic Institutions, and Nonprofits

#73668

pSIREN-RetroQ vector containing shRNA sequence to BPTF

Joe Landry

April 13, 2016

Industry, Academic Institutions, and Nonprofits

#165800

Drosophila HSP70B 3'UTR sequence

Koen Venken

Matinyan et al Cell Rep. 2021 Sep 14;36(11):109700. doi

Sept. 14, 2021

Academic Institutions and Nonprofits only

#100557

Expresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGC

Dustin Maly

Rose et al Nat Methods. 2017 Jul 24. doi: 10.1038/n

Sept. 27, 2017

Academic Institutions and Nonprofits only

#120789

Part of GoldenGate Yarrowia lipolytica toolkit for assembling an expression plasmid for Y. lipolytic yeast. Sequence for homologous integration into Y. lipolytica genome. Linearization of cassette by NotI restriction enzyme after the assembly

Tristan Rossignol

Larroude et al Microb Biotechnol. 2019 May 31. doi: 10.

Nov. 13, 2019

Academic Institutions and Nonprofits only

#120788

Part of GoldenGate Yarrowia lipolytica toolkit for assembling an expression plasmid for Y. lipolytic yeast. Sequence for homologous integration into Y. lipolytica genome. Linearization of cassette by NotI restriction enzyme after the assembly

Tristan Rossignol

Larroude et al Microb Biotechnol. 2019 May 31. doi: 10.

Nov. 13, 2019

Academic Institutions and Nonprofits only