We narrowed to 46,024 results for: cha
-
Plasmid#195039PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC-SUR-YR
Plasmid#61768PurposeYeast recombinational cloning compatible Agrobacterium tumefaciens ternary vector containing sulfonylurea resistance gene (ILV alelle from Magnaporthe oyrzae) on transfer DNA (TDNA).DepositorInsertsSur gene
2 micron origin or replication and URA3 gene for S. cerevisiae
UseTernary vector for agrobacterium mediated transfo…PromoterMagnaporthe oryzae ILV promoterAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-P2A-GFP-PGK-Puro
Plasmid#110861PurposeLentiviral vector for constitutive expression of Cas9-VQR-P2A-GFP (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
natMX6-ins5
Plasmid#195042PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tCYC1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
hum alpha ENAC promoter a25-a23
Plasmid#83427Purposepromoter reporter construct to test 5' flanking sequencesDepositorInserthuman aENaC gene 5' flanking seq + 55 nt of the 5' UTR for exon 1A (SCNN1A Human)
UseLuciferaseTagsLuciferasePromoteralpha ENACAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN(GFP)-HA-Slc1a5 (mouse)
Plasmid#71458Purposeinducible expression fo Slc1a5 in mammalian cellsDepositorInsertSlc1a5 (Slc1a5 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationA85P, L125F and V384A mutations compared to GenBa…PromoterCMVAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pROS11
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD5 (OTU, aa 171-358)
Plasmid#61415PurposeExpresses human OTUD5 (OTU domain) in E. coli.DepositorInsertOTUD5 (OTUD5 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-170 and aa 359-571.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-S (Wuhan variant)
Plasmid#169846PurposeMammalian expression plasmid for S of SARS-CoV-2 (Wuhan variant) with N-terminal c-myc tagDepositorInsertProtein S
TagsHA leader and c-myc tagExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only