We narrowed to 46,057 results for: cha
-
Plasmid#122441PurposeExpresses disordered protein FUS(1-214) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertFUS (FUS Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationContains only amino acids 1-214PromoterSFFVAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_D290V
Plasmid#98663PurposeExpresses MBP-tagged full length hnRNPA2 with D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_P298L
Plasmid#104468Purposeexpress MBP-tagged full length hnRNPA2 P298LDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDP044
Plasmid#101168PurposepUDP004 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes SeATF1 and SeATF2 and Spcas9D147Y P411T in S. pastorianus (HH-gRNASeATF1-HDV-linker-HH-gRNASeATF2-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
His6-SMT3-SopB(C460S)
Plasmid#183677PurposeRecombinant Salmonella Typhimurium SopB (catalytically inactive)DepositorInsertsopB (sopB Budding Yeast, Salmonella enterica serovar Typhimurium)
TagsHis6-S. cerevisiae SMT3(2-101)ExpressionBacterialMutationC460SPromoterT7Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-P2A-GFP-PGK-Puro
Plasmid#110864PurposeLentiviral vector for constitutive expression of Cas9-VQRRA-P2A-GFP in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-ALG13 (OTU, aa 216-353)
Plasmid#61414PurposeExpresses human ALG13 (OTU domain) in E. coli.DepositorInsertALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) (ALG13 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-215 and aa 354-1137.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/HisMaxB-YAP2-1st&2nd WW mutant
Plasmid#19000DepositorInsertYes-kinase associated protein (YAP1 Human)
TagsHisExpressionMammalianMutationTryptophan 199 changed to Alanine, and Proline 2…Available SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only