We narrowed to 5,812 results for: 129
-
Plasmid#240284PurposeThe plasmid will package wild-type human Tau (hMAPT) as a T2A fusion with EGFP from a CMV promoterDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
-
-
-
-
-
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
XLone-CRNDEUCE (5 kb)
Plasmid#242179PurposeExpress doxycycline inducible 5 kb UCE-containing CRNDE in mammalian cellsDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCh-CRY2-sspB2
Plasmid#223691PurposePhoBIT2 component; sspB2 (sspB mutant A56F) fused to mCh-CRY2PHRDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1-N2 (1-399)
Plasmid#225452PurposeExpress mEGFP-fusion protein of FXR1 fragment (1-399)DepositorAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1-N1 (1-379)
Plasmid#225450PurposeExpress mEGFP-fusion protein of FXR1 fragment (1-379)DepositorAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA giantin/GOLGB1
Plasmid#222315PurposeCRISPR/Cas9 close to the ATG of giantin/GOLGB1 gene.DepositorInsertgRNA targeting GOLB1 (GOLGB1 Human)
UseCRISPRAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRII-dgat2 in situ probe
Plasmid#232134Purposezebrafish dgat2 anti-sense in situ probe, linearize with BamHI, T7 polymeraseDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB222
Plasmid#221772PurposeBacterial expression of 10xHis-SUMO (Smt3) fusion to Sec7 domain (687-885) of Big1 (ArfGEF1) for rapid nucleotide exchange and activation of Arf GTPasesDepositorAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC1mut (N202P)
Plasmid#225455PurposeExpress mEGFP-fusion protein of FXR1 isoform a (N202P)DepositorAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-Ccswap
Plasmid#225460PurposeExpress EGFP-fusion protein of FXR1 isoform a (CCswap)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsEGFPExpressionMammalianMutationCCswap (swapped positions of CC2 and CC1)PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC1-CC1
Plasmid#225458PurposeExpress EGFP-fusion protein of FXR1 isoform a (CC1-CC1)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsEGFPExpressionMammalianMutationCC2 replaced with a second copy of CC1PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1-N1-KH1mut (T236D H237D)
Plasmid#225453PurposeExpress mEGFP-fusion protein of FXR1 isoform a (T236D H237D)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsmEGFPExpressionMammalianMutationT236D H237DPromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-tevopreq1-FXR1-G266E
Plasmid#225482PurposeExpress epegRNA for FXR1DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC2mut (V361P)
Plasmid#225456PurposeExpress mEGFP-fusion protein of FXR1 isoform a (V361P)DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC2-CC2
Plasmid#225459PurposeExpress mEGFP-fusion protein of FXR1 isoform a (CC2-CC2)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsmEGFPExpressionMammalianMutationCC1 replaced with a second copy of CC2PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-FXR1-KH1-gRNA
Plasmid#225483PurposeExpress gRNA for FXR1DepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-FXR1-N202S-gRNA
Plasmid#225481PurposeExpress gRNA for FXR1DepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-EGFP-GAPDH-Tudor-R rich
Plasmid#225478PurposeExpress mEGFP-GAPDH-Tudor-R fusionDepositorInsertGAPDH fused with Tudor and R-rich regions of TDRD3 (GAPDH Human)
TagsmEGFPExpressionMammalianPromoterCMVAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21a Di-iPGM
Plasmid#180241PurposeBacterial expression plasmid for production of recombinant Dirofilaria immitis iPGM His10DepositorInsertDirofilaria immitis iPGM-10His
TagsHisExpressionBacterialPromoterT7Available SinceOct. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC086
Plasmid#202213PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Gentamicin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertpBCC25, pBCC33, pBCC55, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC091
Plasmid#202218PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertpBCC25, pBCC30, pBCC55, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBCC100
Plasmid#202226PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertpBCC25, pBCC32, pBCC55, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
ExpressionBacterialAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3-hARL1(Q71L)
Plasmid#206407PurposeMammalian expression of hARL1(Q71L)DepositorAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N3-hARL1(T31N)
Plasmid#206408PurposeMammalian expression of hARL1(T31N)DepositorAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-EGFP-C1-HsNot9_S
Plasmid#147493PurposeMammalian Expression of HsNot9DepositorInsertHsNot9 (CNOT9 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HsNot9-HA-MBP_S
Plasmid#147483PurposeMammalian Expression of HsNot9DepositorInsertHsNot9 (CNOT9 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRB116.2
Plasmid#181946PurposeaTc-inducible expression of TorR with C-terminal mNeonGreen fusion. Also contains mCherry under TorR-controlled promoter PtorCAD129DepositorInsertTagsmNeonGreenExpressionBacterialPromoterTorR-mNG-PLtetO-1; mCherry-PtorCAD129; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB120.2
Plasmid#181947PurposeaTc-inducible expression of TorR with N-terminal mNeonGreen fusion. Also contains mCherry under TorR-controlled promoter PtorCAD129DepositorInsertTagsmNeonGreenExpressionBacterialPromotermNG-TorR-PLtetO-1; mCherry-PtorCAD129; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_CSF1R
Plasmid#187767PurposeMAC-tagged gene expression of human CSF1RDepositorInsertCSF1R (CSF1R Human)
ExpressionMammalianAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_PARRC_150-189 (pBS0658)
Plasmid#185201PurposeFor the mammalian expression of the tardigrade protein CAHS1_PARRC_150-189. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_PARRC_150-189
ExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_A234G (pBS0816)
Plasmid#185267PurposeFor the mammalian expression of the human protein APOE_HUMAN_A234G. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_A234G
ExpressionMammalianMutationA234GAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_D4NWF2_DrHD_b03_dom3 (pBS0681)
Plasmid#185207PurposeFor the mammalian expression of the Deinococcus radiodurans protein D4NWF2_DrHD_b03_dom3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertD4NWF2_DrHD_b03_dom3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_AfLEA1.1 (pBS0741)
Plasmid#185233PurposeFor the mammalian expression of the brine shrimp protein AfLEA1.1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAfLEA1.1
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_51-88 (pBS0734)
Plasmid#185230PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_51-88. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_51-88
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_5 (pBS0731)
Plasmid#185228PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_5. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_shuffle_5
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_3 (pBS0729)
Plasmid#185227PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_1 (pBS0727)
Plasmid#185226PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_shuffle_1
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_5 (pBS0722)
Plasmid#185225PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_5. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_5
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_3 (pBS0720)
Plasmid#185224PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_mutant_3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only