We narrowed to 8,503 results for: Set
-
Plasmid#227667PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. KmR, easily curable via sucrose counterselection.DepositorInsertKmR
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-4
Plasmid#227668PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. SmR, easily curable via sucrose counterselection.DepositorInsertSmR
UseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin C3
Plasmid#199610PurposeEncodes N-terminal eGFP-tagged gephyrin including the C3 splice cassette for expression in mammalian cells.DepositorInsertGephyrin (Gphn Rat)
UseTagsEGFPExpressionMammalianMutationC3 cassette insertionPromoterCMVAvailable sinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC2-gephyrin C4a
Plasmid#199611PurposeEncodes N-terminal eGFP-tagged gephyrin including the C4a splice cassette for expression in mammalian cells.DepositorInsertGephyrin (Gphn Rat)
UseTagsEGFPExpressionMammalianMutationC4a casette insertionPromoterCMVAvailable sinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e5-S253T
Plasmid#129755PurposeGene targeting in marmoset cellsDepositorInsertPLP1 (PLP1 C. jacchus (common marmost))
UseMarmoset targetingTagsExpressionMutationS253TPromoterAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e5-P216S
Plasmid#129754PurposeGene targeting in marmoset cellsDepositorInsertPLP1 (PLP1 C. jacchus (common marmost))
UseMarmoset targetingTagsExpressionMutationP216SPromoterAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-P15L-_lox
Plasmid#129756PurposeGene targeting in marmoset cellsDepositorInsertPLP1 (PLP1 C. jacchus (common marmost))
UseMarmoset targetingTagsExpressionMutationP15LPromoterAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e1-EGFP
Plasmid#129751PurposeGene targeting in marmoset cellsDepositorInsertPLP1 (PLP1 C. jacchus (common marmost))
UseMarmoset targetingTagsEGFPExpressionMutationPromoterAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
BLADE
Plasmid#134912PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades systemDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterU6Available sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
BLADE-182
Plasmid#134914PurposesgRNA targeting GFP to be used in nanoblade systemDepositorInsertGFP
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterU6Available sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUC2::GNSI (NrsR)
Plasmid#121537PurposeThis plasmid contains a CYC1pr driven GNSI reporter and flanking homology to SUC2. Digestion with NotI, SacI, and EcoRV, allows integration at the SUC2 locus.DepositorInsertsCYC1 Promoter (CYC1 Budding Yeast)
Nyv1 Cytosolic Domain (aa 6-230)
Snc1 Transmembrane Domain (TMD)
SUC2 CDS
SUC2 terminator
NrsR
UseTagsmGFP5ExpressionYeastMutationM109I (Naturally occurring SNP) and The first 21 …PromoterAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCYC1pr-GNSI (LEU)
Plasmid#111450PurposeGNSI is a synthetic, genetically-encoded reporter that allows rapid plate-based assessment of AP-3 functional deficiency, using either colorimetric or growth phenotype readouts.DepositorInsertsCYC1 Promoter (CYC1 Budding Yeast)
Nyv1 Cytosolic Domain (aa 6-230)
Snc1 Transmembrane Domain (TMD)
SUC2 CDS
SUC2 terminator
UseTagsmGFP5ExpressionYeastMutationM109I (Naturally occurring SNP) and The first 21 …PromoterAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 N. meningitidis sgRNA BfuAI large stuffer
Plasmid#86195PurposeU6 based expression of N meningitidis sgRNADepositorInsertnmCas9 sgRNA cloning cassete
UseLentiviralTagsExpressionMutationPromoterU6Available sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only