We narrowed to 8,399 results for: GAL
-
Plasmid#124090PurposeFGF6-V5 tagged expression vectorDepositorInsertFGF6 (FGF6 Human)
UseLentiviralTagsV5Mutation3 silent SNPs: (189) C>G, (366) T>C and (41…Available SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1-KS
Plasmid#237679PurposeFor overexpression of mEGFP-SS18-SSX1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1
Plasmid#237678PurposeFor overexpression of mEGFP-SS18-SSX1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX2-KS
Plasmid#237680PurposeFor overexpression of mEGFP-SS18-SSX2-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-1
Plasmid#237634PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-FUS-repair-tempate
Plasmid#237684PurposeFor knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-BD-SARS-CoV-2-S-tail-Thr1273Glu
Plasmid#218458PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (Thr1273Glu substitution) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying Thr1273Glu substitution and an N-terminal GST-tag (S SARS-CoV-2)
TagsGSTExpressionBacterialMutationThr1273Glu substitutionAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only